microRNA information: hsa-miR-422a
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-422a | miRbase |
| Accession: | MIMAT0001339 | miRbase |
| Precursor name: | hsa-mir-422a | miRbase |
| Precursor accession: | MI0001444 | miRbase |
| Symbol: | MIR422A | HGNC |
| RefSeq ID: | NR_029944 | GenBank |
| Sequence: | ACUGGACUUAGGGUCAGAAGGC |
Reported expression in cancers: hsa-miR-422a
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-422a | colorectal cancer | downregulation | "Screening for downregulated miRNAs in CRC tissues ......" | 25845814 | Microarray; qPCR |
| hsa-miR-422a | colorectal cancer | downregulation | "miR 422a is an independent prognostic factor and f ......" | 27350737 | qPCR |
| hsa-miR-422a | glioblastoma | downregulation | "In this study we observed that miR-422a was downre ......" | 27648359 | qPCR |
| hsa-miR-422a | sarcoma | downregulation | "In this study the expression levels of miRNAs were ......" | 26423405 | qPCR |
Reported cancer pathway affected by hsa-miR-422a
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-422a | NA | NA | "NA ......" | NA | NA |
| hsa-miR-422a | " ......" |
Reported cancer prognosis affected by hsa-miR-422a
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-422a | colorectal cancer | staging | "We chose miR-215 miR-375 miR-378 miR-422a and miR- ......" | 22469014 | |
| hsa-miR-422a | colorectal cancer | worse prognosis; poor survival | "Screening for downregulated miRNAs in CRC tissues ......" | 25845814 | |
| hsa-miR-422a | colorectal cancer | tumorigenesis; metastasis; staging; poor survival; worse prognosis; progression | "miR 422a is an independent prognostic factor and f ......" | 27350737 | |
| hsa-miR-422a | head and neck cancer | recurrence; staging; poor survival | "MiR 422a promotes loco regional recurrence by targ ......" | 27281619 | |
| hsa-miR-422a | liver cancer | metastasis; recurrence; tumorigenesis | "Double negative feedback loop between microRNA 422 ......" | 25251503 | RNAi |
| hsa-miR-422a | liver cancer | recurrence; poor survival | "In the present study TaqMan Real-time PCR microRNA ......" | 26176380 | |
| hsa-miR-422a | sarcoma | worse prognosis; staging; metastasis; tumor size; poor survival | "Tissue expression levels of miR 29b and miR 422a i ......" | 26423405 |
Reported gene related to hsa-miR-422a
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-422a | liver cancer | FOXQ1 | "Our findings show the critical roles of miR-422a a ......" | 25251503 |
| hsa-miR-422a | head and neck cancer | NT5E | "Indeed modulation of the endogenous level of miR-4 ......" | 27281619 |
| hsa-miR-422a | glioblastoma | PIK3CA | "MiR 422a acts as a tumor suppressor in glioblastom ......" | 27648359 |