microRNA information: hsa-miR-429

SectionIDlink
Mature name: hsa-miR-429miRbase
Accession: MIMAT0001536miRbase
Precursor name: hsa-mir-429 miRbase
Precursor accession: MI0001641miRbase
Symbol: MIR429HGNC
RefSeq ID: NR_029957GenBank
Sequence: UAAUACUGUCUGGUAAAACCGU



Reported expression in cancers: hsa-miR-429

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-429

bladder cancerderegulation"In other recruited 17 patients with BUC who were d ......"22886973Reverse transcription PCR; Microarray
hsa-miR-429

breast cancerdownregulation"Expression levels of miR-200a miR-200b miR-200c mi ......"26201425qPCR
hsa-miR-429

colorectal cancerdownregulation"miR 429 identified by dynamic transcriptome analys ......"24237355qPCR; Microarray
hsa-miR-429

colorectal cancerdownregulation"miR-429 a member of the miR-200 family of microRNA ......"24402783
hsa-miR-429

colorectal cancerdownregulation"Effect of evodiamine and berberine on miR 429 as a ......"27462166
hsa-miR-429

endometrial cancerupregulation"We evaluated the differential expressions of miRNA ......"21035172Microarray
hsa-miR-429

endometrial cancerupregulation"Using integrated statistical analyses we identifie ......"25750291
hsa-miR-429

gastric cancerupregulation"Thus the differential expression of a panel of miR ......"26171025Microarray; qPCR
hsa-miR-429

gastric cancerupregulation"MiR 429 regulates gastric cancer cell invasiveness ......"26472725
hsa-miR-429

gastric cancerupregulation"MiR-429 has been recently reported to inhibit GC g ......"26513239
hsa-miR-429

glioblastomaupregulation"Very recently miR-429 was reported to have a poten ......"26511969
hsa-miR-429

kidney renal cell cancerdownregulation"Our recent studies of microRNA miRNA expression si ......"23635949
hsa-miR-429

kidney renal cell cancerdownregulation"MiR 429 is linked to metastasis and poor prognosis ......"27619681
hsa-miR-429

kidney renal cell cancerdownregulation"MicroRNA miR-429 has been frequently reported to b ......"27698878
hsa-miR-429

lung cancerupregulation"Expression of miR 29c miR 93 and miR 429 as potent ......"24523873qPCR; Microarray
hsa-miR-429

lung squamous cell cancerupregulation"In this study we demonstrated that the expression ......"24866238
hsa-miR-429

ovarian cancerdownregulation"Real-time polymerase chain reaction RT-PCR was per ......"24805828qPCR; Microarray
hsa-miR-429

ovarian cancerupregulation"To identify the micro-ribonucleic acids miRNAs exp ......"24816756qPCR
hsa-miR-429

ovarian cancerderegulation"Diagnostic and prognostic potential of serum miR 7 ......"26393886Microarray
hsa-miR-429

prostate cancerupregulation"miR-429 expression levels were measured in the IF1 ......"25351256qPCR



Reported cancer pathway affected by hsa-miR-429

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-429

bladder cancerEpithelial mesenchymal transition pathway"MiR 429 reverses epithelial mesenchymal transition ......"27058893Western blot
hsa-miR-429

breast cancerApoptosis pathway"miR 429 mediates δ tocotrienol induced apoptosis ......"26629059
hsa-miR-429

colon cancerEpithelial mesenchymal transition pathway"In this study we systematically demonstrate that A ......"25371200
hsa-miR-429

colon cancerApoptosis pathway"By performing MTT wound-healing and Transwell migr ......"27460529Flow cytometry; Cell migration assay
hsa-miR-429

colorectal cancerApoptosis pathway"MiR 429 is an independent prognostic factor in col ......"23111103
hsa-miR-429

esophageal cancerApoptosis pathway"MiR 429 up regulation induces apoptosis and suppre ......"23999873Western blot; Luciferase
hsa-miR-429

gastric cancerApoptosis pathway"This study was aimed to investigate the regulation ......"23554776Flow cytometry
hsa-miR-429

gastric cancerApoptosis pathway"MiR 429 Induces Gastric Carcinoma Cell Apoptosis T ......"26513239Luciferase; Flow cytometry
hsa-miR-429

glioblastomaApoptosis pathway"MiR 429 induces apoptosis of glioblastoma cell thr ......"26511969Luciferase
hsa-miR-429

kidney renal cell cancerEpithelial mesenchymal transition pathway"Our recent studies of microRNA miRNA expression si ......"23635949
hsa-miR-429

kidney renal cell cancerEpithelial mesenchymal transition pathway"MicroRNA 429 suppresses cell proliferation epithel ......"25953723Colony formation
hsa-miR-429

kidney renal cell cancerEpithelial mesenchymal transition pathway"MiR 429 is linked to metastasis and poor prognosis ......"27619681
hsa-miR-429

ovarian cancerApoptosis pathway"Diagnostic and prognostic potential of serum miR 7 ......"26393886
hsa-miR-429

prostate cancercell cycle pathway"Downregulation of microRNA 429 inhibits cell proli ......"25351256Luciferase
hsa-miR-429

sarcomaApoptosis pathway"Tumor suppressing effects of miR 429 on human oste ......"24633485



Reported cancer prognosis affected by hsa-miR-429

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-429

bladder cancerprogression"MiR 429 reverses epithelial mesenchymal transition ......"27058893Western blot
hsa-miR-429

breast cancerdrug resistance"We created a doxorubicin-resistant MCF-7 MCF-/Adr ......"25451164MTT assay
hsa-miR-429

colon cancerdifferentiation"In the present study we isolated a population of c ......"21130073Flow cytometry
hsa-miR-429

colon cancerprogression"MicroRNA 429 inhibits the migration and invasion o ......"26058485Western blot
hsa-miR-429

colorectal cancermetastasis"Applying real-time PCR we detected the expression ......"21827717
hsa-miR-429

colorectal cancermetastasis; worse prognosis; tumor size"MiR 429 is an independent prognostic factor in col ......"23111103
hsa-miR-429

colorectal cancerworse prognosis; staging; progression"miR 429 identified by dynamic transcriptome analys ......"24237355
hsa-miR-429

colorectal cancertumorigenesis"MiR 429 inhibits cells growth and invasion and reg ......"24402783
hsa-miR-429

colorectal cancerstaging; poor survival"Tumor tissue samples were obtained from 127 surgic ......"24510588
hsa-miR-429

colorectal cancerstaging; metastasis; tumor size; drug resistance; poor survival; malignant trasformation; worse prognosis"The Clinical Significance of MiR 429 as a Predicti ......"27654003
hsa-miR-429

esophageal cancerstaging; metastasis; differentiation"In this study we performed a miRNA microarray to a ......"24272087
hsa-miR-429

gastric cancermetastasis"miR 429 modulates the expression of c myc in human ......"21684154Western blot; Luciferase
hsa-miR-429

gastric cancerstaging; metastasis"In the first step of this study preliminary experi ......"26233325
hsa-miR-429

gastric cancerpoor survival"MiR 429 Induces Gastric Carcinoma Cell Apoptosis T ......"26513239Luciferase; Flow cytometry
hsa-miR-429

glioblastomapoor survival"MiR 429 induces apoptosis of glioblastoma cell thr ......"26511969Luciferase
hsa-miR-429

kidney renal cell cancerstaging"This study aims to profile dysregulated microRNA m ......"25938468
hsa-miR-429

kidney renal cell cancermetastasis; progression; tumorigenesis"MicroRNA 429 suppresses cell proliferation epithel ......"25953723Colony formation
hsa-miR-429

kidney renal cell cancerpoor survival"Using vote-counting strategy and robust rank aggre ......"25974855
hsa-miR-429

kidney renal cell cancermetastasis; worse prognosis; poor survival; motility"MiR 429 is linked to metastasis and poor prognosis ......"27619681
hsa-miR-429

kidney renal cell cancercell migration; metastasis"Tumor suppressing effects of microRNA 429 in human ......"27698878Luciferase; Western blot
hsa-miR-429

lung cancerstaging; worse prognosis; poor survival"Expression of miR 29c miR 93 and miR 429 as potent ......"24523873
hsa-miR-429

lung cancerprogression"Interestingly mir-200 family mir-200a mir-200b and ......"27695346
hsa-miR-429

lung squamous cell cancertumorigenesis; metastasis"MicroRNA 429 induces tumorigenesis of human non sm ......"24866238
hsa-miR-429

ovarian cancerworse prognosis"The microRNA expression profiles were examined usi ......"18451233
hsa-miR-429

ovarian cancerstaging; poor survival; recurrence"By performing miRNA expression profiling analysis ......"19501389
hsa-miR-429

ovarian cancermetastasis"Overexpression of miR 429 induces mesenchymal to e ......"21277012
hsa-miR-429

ovarian cancermetastasis; staging; recurrence"Ectopic over expression of miR 429 induces mesench ......"24802724
hsa-miR-429

ovarian cancerdrug resistance"Hybridization was carried out on miRNA microarray ......"24805828
hsa-miR-429

ovarian cancerprogression"The aberrant expression of the miR-200 family miR- ......"24952258
hsa-miR-429

ovarian cancerstaging; poor survival; cell migration"Diagnostic and prognostic potential of serum miR 7 ......"26393886
hsa-miR-429

ovarian cancerdrug resistance"KIAA0101 a target gene of miR 429 enhances migrati ......"27708548Western blot; Cell proliferation assay; Colony formation; Cell Proliferation Assay; Transwell assay; Luciferase



Reported gene related to hsa-miR-429

miRNAcancergenereportingPUBMED
hsa-miR-429

bladder cancerZEB1"MiR-429 downstream target ZEB1 was decreased E-cad ......"27058893
hsa-miR-429

breast cancerZEB1"Here we show that 53BP1 negatively regulated EMT b ......"26011542
hsa-miR-429

gastric cancerZEB1"Here we showed that miR-429 levels were significan ......"26472725
hsa-miR-429

sarcomaZEB1"In conclusion miR-429 serves as a tumor suppressor ......"24633485
hsa-miR-429

esophageal cancerBCL2"MiR 429 up regulation induces apoptosis and suppre ......"23999873
hsa-miR-429

gastric cancerBCL2"MiR 429 Induces Gastric Carcinoma Cell Apoptosis T ......"26513239
hsa-miR-429

glioblastomaBCL2"MiR 429 induces apoptosis of glioblastoma cell thr ......"26511969
hsa-miR-429

bladder cancerCDH1"MiR 429 reverses epithelial mesenchymal transition ......"27058893
hsa-miR-429

colorectal cancerCDH1"This study was designed to investigate the changes ......"27462166
hsa-miR-429

kidney renal cell cancerCDH1"In addition ectopic expression of miR-429 in 786-0 ......"27619681
hsa-miR-429

gastric cancerMYC"miR 429 modulates the expression of c myc in human ......"21684154
hsa-miR-429

sarcomaMYC"It is known that miR-429 is down-regulated and fun ......"24633485
hsa-miR-429

esophageal cancerSP1"Subsequent Western blotting and luciferase reporte ......"23999873
hsa-miR-429

kidney renal cell cancerSP1"Tumor suppressing effects of microRNA 429 in human ......"27698878
hsa-miR-429

kidney renal cell cancerBMI1"MicroRNA 429 suppresses cell proliferation epithel ......"25953723
hsa-miR-429

prostate cancerCDKN1B"Downregulation of microRNA 429 inhibits cell proli ......"25351256
hsa-miR-429

kidney renal cell cancerE2F3"MicroRNA 429 suppresses cell proliferation epithel ......"25953723
hsa-miR-429

gastric cancerFSCN1"miR 429 functions as a tumor suppressor by targeti ......"27042104
hsa-miR-429

ovarian cancerKIAA0101"KIAA0101 a target gene of miR 429 enhances migrati ......"27708548
hsa-miR-429

kidney renal cell cancerLARP6"miR-429 expression was stably up-regulated or down ......"25953723
hsa-miR-429

bladder cancerMMP2"Cell invasive ability was also inhibited by exogen ......"27058893
hsa-miR-429

ovarian cancerMUC16"The levels of miR-429 positively correlated with C ......"26393886
hsa-miR-429

colorectal cancerONECUT2"MiR 429 inhibits cells growth and invasion and reg ......"24402783
hsa-miR-429

colon cancerPAK6"Investigation of the molecular mechanism showed th ......"26058485
hsa-miR-429

colorectal cancerSOX2"MiR 429 is an independent prognostic factor in col ......"23111103
hsa-miR-429

breast cancerTP53BP1"Here we show that 53BP1 negatively regulated EMT b ......"26011542
hsa-miR-429

breast cancerXIAP"miR 429 mediates δ tocotrienol induced apoptosis ......"26629059
hsa-miR-429

gastric cancerZEB2"Here we showed that miR-429 levels were significan ......"26472725



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-429
ERRFI1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD
miRNAWalker2 validate; MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.069; TCGA BRCA -0.069; TCGA CESC -0.105; TCGA COAD -0.115; TCGA ESCA -0.109; TCGA HNSC -0.106; TCGA KIRC -0.181; TCGA LUAD -0.127; TCGA LUSC -0.158; TCGA STAD -0.198
hsa-miR-429
KLHL20
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; OV; PAAD; STAD; UCEC
miRNAWalker2 validate; miRanda; miRNATAP
TCGA BLCA -0.067; TCGA BRCA -0.126; TCGA CESC -0.07; TCGA COAD -0.107; TCGA HNSC -0.087; TCGA KIRC -0.086; TCGA KIRP -0.114; TCGA OV -0.055; TCGA PAAD -0.086; TCGA STAD -0.077; TCGA UCEC -0.133
hsa-miR-429
MYC
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.269; TCGA BRCA -0.108; TCGA CESC -0.351; TCGA ESCA -0.096; TCGA KIRC -0.39; TCGA KIRP -0.417; TCGA LUAD -0.178; TCGA PAAD -0.193; TCGA PRAD -0.09; TCGA THCA -0.052; TCGA UCEC -0.167
hsa-miR-429
PTPRD
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNAWalker2 validate; miRanda; miRNATAP
TCGA BLCA -0.458; TCGA BRCA -0.207; TCGA CESC -0.258; TCGA ESCA -0.422; TCGA HNSC -0.536; TCGA LUAD -0.1; TCGA LUSC -0.402; TCGA OV -0.255; TCGA PAAD -0.215; TCGA STAD -0.221; TCGA UCEC -0.356
hsa-miR-429
RASSF2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRNATAP
TCGA BLCA -0.087; TCGA BRCA -0.101; TCGA CESC -0.188; TCGA COAD -0.493; TCGA ESCA -0.211; TCGA HNSC -0.288; TCGA KIRC -0.479; TCGA KIRP -0.108; TCGA LUAD -0.146; TCGA LUSC -0.474; TCGA PAAD -0.477; TCGA PRAD -0.077; TCGA STAD -0.237; TCGA UCEC -0.249
hsa-miR-429
SEPT7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.084; TCGA BRCA -0.055; TCGA CESC -0.077; TCGA COAD -0.094; TCGA ESCA -0.092; TCGA HNSC -0.093; TCGA KIRC -0.118; TCGA LUAD -0.075; TCGA LUSC -0.06; TCGA PAAD -0.132; TCGA STAD -0.123; TCGA UCEC -0.133
hsa-miR-429
WASF3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; THCA; STAD; UCEC
miRNAWalker2 validate; miRTarBase; PITA; miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.384; TCGA CESC -0.332; TCGA COAD -0.578; TCGA ESCA -0.348; TCGA HNSC -0.095; TCGA LUSC -0.353; TCGA OV -0.13; TCGA PAAD -0.214; TCGA THCA -0.07; TCGA STAD -0.318; TCGA UCEC -0.251
hsa-miR-429
ZEB1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.353; TCGA BRCA -0.317; TCGA CESC -0.363; TCGA COAD -0.59; TCGA ESCA -0.295; TCGA HNSC -0.44; TCGA KIRC -0.184; TCGA KIRP -0.121; TCGA LUAD -0.221; TCGA LUSC -0.403; TCGA OV -0.139; TCGA PAAD -0.294; TCGA PRAD -0.108; TCGA STAD -0.431; TCGA UCEC -0.455
hsa-miR-429
ZEB2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; MirTarget; miRanda; miRNATAP
TCGA BLCA -0.398; TCGA BRCA -0.341; TCGA CESC -0.356; TCGA COAD -0.551; TCGA ESCA -0.281; TCGA HNSC -0.48; TCGA KIRC -0.198; TCGA LUAD -0.288; TCGA LUSC -0.524; TCGA PAAD -0.398; TCGA PRAD -0.123; TCGA STAD -0.244; TCGA UCEC -0.343
hsa-miR-429
ZFPM2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNAWalker2 validate; miRTarBase; PITA; miRanda; miRNATAP
TCGA BLCA -0.483; TCGA BRCA -0.362; TCGA CESC -0.269; TCGA COAD -0.789; TCGA ESCA -0.474; TCGA HNSC -0.487; TCGA KIRC -0.228; TCGA LUAD -0.262; TCGA LUSC -0.479; TCGA OV -0.183; TCGA PAAD -0.446; TCGA PRAD -0.197; TCGA STAD -0.476; TCGA UCEC -0.618
hsa-miR-429
LIX1L
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.27; TCGA BRCA -0.216; TCGA CESC -0.217; TCGA COAD -0.351; TCGA ESCA -0.244; TCGA HNSC -0.241; TCGA KIRC -0.214; TCGA KIRP -0.067; TCGA LUAD -0.101; TCGA LUSC -0.234; TCGA OV -0.088; TCGA PAAD -0.164; TCGA STAD -0.318; TCGA UCEC -0.276
hsa-miR-429
HLF
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.451; TCGA BRCA -0.484; TCGA COAD -0.375; TCGA ESCA -0.282; TCGA LIHC -0.17; TCGA PAAD -0.191; TCGA PRAD -0.066; TCGA STAD -0.633; TCGA UCEC -0.526
hsa-miR-429
AFF3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.428; TCGA BRCA -0.13; TCGA CESC -0.291; TCGA COAD -0.57; TCGA ESCA -0.372; TCGA HNSC -0.26; TCGA KIRC -0.312; TCGA KIRP -0.303; TCGA LUSC -0.537; TCGA PAAD -0.487; TCGA PRAD -0.201; TCGA THCA -0.077; TCGA STAD -0.456; TCGA UCEC -0.22
hsa-miR-429
WIPF1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.352; TCGA BRCA -0.149; TCGA CESC -0.37; TCGA COAD -0.454; TCGA ESCA -0.286; TCGA HNSC -0.317; TCGA KIRC -0.331; TCGA KIRP -0.221; TCGA LUAD -0.213; TCGA LUSC -0.369; TCGA PAAD -0.364; TCGA PRAD -0.056; TCGA STAD -0.186; TCGA UCEC -0.209
hsa-miR-429
CNN3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.138; TCGA BRCA -0.072; TCGA CESC -0.13; TCGA COAD -0.157; TCGA ESCA -0.142; TCGA HNSC -0.216; TCGA LIHC -0.085; TCGA LUAD -0.14; TCGA LUSC -0.131; TCGA PAAD -0.242; TCGA PRAD -0.059; TCGA STAD -0.2; TCGA UCEC -0.129
hsa-miR-429
SYDE1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.279; TCGA BRCA -0.168; TCGA CESC -0.501; TCGA COAD -0.453; TCGA ESCA -0.306; TCGA HNSC -0.292; TCGA KIRC -0.207; TCGA KIRP -0.108; TCGA LUAD -0.245; TCGA LUSC -0.28; TCGA OV -0.117; TCGA PAAD -0.188; TCGA PRAD -0.074; TCGA STAD -0.283; TCGA UCEC -0.361
hsa-miR-429
ABL2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
MirTarget
TCGA BLCA -0.135; TCGA CESC -0.127; TCGA COAD -0.124; TCGA ESCA -0.132; TCGA HNSC -0.157; TCGA KIRC -0.22; TCGA KIRP -0.086; TCGA LUAD -0.083; TCGA LUSC -0.164; TCGA PAAD -0.165; TCGA STAD -0.051
hsa-miR-429
FN1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.527; TCGA CESC -0.489; TCGA COAD -0.784; TCGA ESCA -0.467; TCGA HNSC -0.586; TCGA KIRC -0.526; TCGA KIRP -0.636; TCGA LUAD -0.311; TCGA LUSC -0.514; TCGA PAAD -0.245; TCGA PRAD -0.118; TCGA STAD -0.333; TCGA UCEC -0.222
hsa-miR-429
ITPR2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.17; TCGA BRCA -0.087; TCGA CESC -0.249; TCGA COAD -0.124; TCGA HNSC -0.335; TCGA KIRP -0.18; TCGA LIHC -0.123; TCGA LUAD -0.112; TCGA LUSC -0.385; TCGA PAAD -0.216; TCGA STAD -0.11; TCGA UCEC -0.065
hsa-miR-429
CBL
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; mirMAP; miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.102; TCGA COAD -0.069; TCGA ESCA -0.068; TCGA HNSC -0.104; TCGA KIRC -0.129; TCGA KIRP -0.07; TCGA LUAD -0.12; TCGA LUSC -0.061; TCGA PAAD -0.138; TCGA PRAD -0.073; TCGA STAD -0.088; TCGA UCEC -0.111
hsa-miR-429
SULF1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.391; TCGA CESC -0.218; TCGA COAD -0.778; TCGA ESCA -0.25; TCGA HNSC -0.357; TCGA KIRC -0.349; TCGA LUAD -0.178; TCGA LUSC -0.185; TCGA PAAD -0.253; TCGA PRAD -0.123; TCGA STAD -0.179
hsa-miR-429
NOVA1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.285; TCGA BRCA -0.444; TCGA CESC -0.288; TCGA COAD -0.773; TCGA ESCA -0.541; TCGA HNSC -0.2; TCGA LUSC -0.242; TCGA OV -0.325; TCGA PAAD -0.355; TCGA STAD -0.544; TCGA UCEC -0.506
hsa-miR-429
MCFD2
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.092; TCGA CESC -0.102; TCGA COAD -0.075; TCGA HNSC -0.18; TCGA KIRC -0.095; TCGA KIRP -0.19; TCGA LIHC -0.071; TCGA LUAD -0.142; TCGA LUSC -0.14; TCGA PAAD -0.113; TCGA PRAD -0.074; TCGA STAD -0.095; TCGA UCEC -0.134
hsa-miR-429
BNC2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.53; TCGA BRCA -0.298; TCGA CESC -0.437; TCGA COAD -0.833; TCGA ESCA -0.46; TCGA HNSC -0.5; TCGA KIRP -0.22; TCGA LUAD -0.292; TCGA LUSC -0.404; TCGA OV -0.163; TCGA PAAD -0.471; TCGA PRAD -0.116; TCGA STAD -0.487; TCGA UCEC -0.586
hsa-miR-429
CLIC4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.367; TCGA BRCA -0.098; TCGA CESC -0.207; TCGA COAD -0.379; TCGA ESCA -0.29; TCGA HNSC -0.159; TCGA LUAD -0.172; TCGA LUSC -0.183; TCGA PAAD -0.253; TCGA PRAD -0.119; TCGA STAD -0.337; TCGA UCEC -0.229
hsa-miR-429
ETS1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.225; TCGA CESC -0.254; TCGA COAD -0.335; TCGA ESCA -0.132; TCGA HNSC -0.36; TCGA KIRC -0.265; TCGA LUAD -0.25; TCGA LUSC -0.468; TCGA PAAD -0.298; TCGA STAD -0.07; TCGA UCEC -0.169
hsa-miR-429
DZIP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.243; TCGA BRCA -0.186; TCGA CESC -0.252; TCGA COAD -0.628; TCGA ESCA -0.478; TCGA HNSC -0.086; TCGA LUAD -0.111; TCGA OV -0.117; TCGA PAAD -0.225; TCGA PRAD -0.062; TCGA STAD -0.389; TCGA UCEC -0.329
hsa-miR-429
VAT1L
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.232; TCGA CESC -0.251; TCGA COAD -0.301; TCGA HNSC -0.306; TCGA LUAD -0.358; TCGA LUSC -0.298; TCGA OV -0.24; TCGA PAAD -0.205; TCGA STAD -0.206; TCGA UCEC -0.374
hsa-miR-429
AMOTL2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.205; TCGA CESC -0.219; TCGA COAD -0.107; TCGA ESCA -0.17; TCGA HNSC -0.157; TCGA LUAD -0.111; TCGA LUSC -0.213; TCGA OV -0.08; TCGA PAAD -0.189; TCGA PRAD -0.088; TCGA STAD -0.108; TCGA UCEC -0.157
hsa-miR-429
NDN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.151; TCGA BRCA -0.377; TCGA CESC -0.33; TCGA COAD -0.519; TCGA ESCA -0.384; TCGA HNSC -0.184; TCGA LUAD -0.126; TCGA LUSC -0.153; TCGA OV -0.268; TCGA PAAD -0.229; TCGA PRAD -0.068; TCGA STAD -0.407; TCGA UCEC -0.39
hsa-miR-429
DUSP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.326; TCGA BRCA -0.373; TCGA CESC -0.236; TCGA COAD -0.324; TCGA ESCA -0.316; TCGA HNSC -0.142; TCGA KIRC -0.237; TCGA LUAD -0.2; TCGA LUSC -0.474; TCGA PAAD -0.25; TCGA STAD -0.254; TCGA UCEC -0.306
hsa-miR-429
GEM
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.461; TCGA BRCA -0.275; TCGA CESC -0.187; TCGA COAD -0.5; TCGA ESCA -0.222; TCGA HNSC -0.33; TCGA KIRC -0.115; TCGA LUSC -0.371; TCGA OV -0.13; TCGA PAAD -0.304; TCGA PRAD -0.115; TCGA STAD -0.369; TCGA UCEC -0.341
hsa-miR-429
VASH1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.091; TCGA CESC -0.202; TCGA COAD -0.323; TCGA ESCA -0.115; TCGA HNSC -0.259; TCGA KIRC -0.417; TCGA LUAD -0.108; TCGA LUSC -0.329; TCGA PAAD -0.201; TCGA STAD -0.057; TCGA UCEC -0.167
hsa-miR-429
RFTN2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.122; TCGA BRCA -0.326; TCGA CESC -0.146; TCGA COAD -0.374; TCGA ESCA -0.097; TCGA HNSC -0.146; TCGA KIRC -0.105; TCGA LUAD -0.143; TCGA LUSC -0.3; TCGA PAAD -0.233; TCGA PRAD -0.07; TCGA STAD -0.184; TCGA UCEC -0.297
hsa-miR-429
SLC35B4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.096; TCGA BRCA -0.117; TCGA CESC -0.117; TCGA COAD -0.132; TCGA ESCA -0.062; TCGA HNSC -0.13; TCGA KIRP -0.139; TCGA LIHC -0.103; TCGA LUAD -0.099; TCGA PAAD -0.129; TCGA STAD -0.09; TCGA UCEC -0.122
hsa-miR-429
SERINC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.104; TCGA BRCA -0.145; TCGA CESC -0.093; TCGA COAD -0.118; TCGA ESCA -0.077; TCGA HNSC -0.155; TCGA KIRP -0.13; TCGA LUAD -0.1; TCGA LUSC -0.155; TCGA PAAD -0.092; TCGA STAD -0.131; TCGA UCEC -0.212
hsa-miR-429
CYTH3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.15; TCGA BRCA -0.171; TCGA CESC -0.119; TCGA COAD -0.185; TCGA ESCA -0.101; TCGA HNSC -0.189; TCGA LUAD -0.064; TCGA LUSC -0.176; TCGA PAAD -0.205; TCGA STAD -0.137; TCGA UCEC -0.125
hsa-miR-429
FSTL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.282; TCGA BRCA -0.295; TCGA CESC -0.205; TCGA COAD -0.499; TCGA ESCA -0.307; TCGA HNSC -0.385; TCGA KIRC -0.385; TCGA LUAD -0.197; TCGA LUSC -0.234; TCGA OV -0.136; TCGA PAAD -0.311; TCGA STAD -0.28; TCGA UCEC -0.182
hsa-miR-429
HCFC2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.11; TCGA BRCA -0.144; TCGA CESC -0.131; TCGA COAD -0.212; TCGA ESCA -0.123; TCGA HNSC -0.17; TCGA KIRP -0.067; TCGA LUAD -0.092; TCGA LUSC -0.144; TCGA PAAD -0.136; TCGA PRAD -0.052; TCGA STAD -0.204; TCGA UCEC -0.174
hsa-miR-429
OSTM1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.178; TCGA BRCA -0.138; TCGA CESC -0.168; TCGA COAD -0.162; TCGA ESCA -0.183; TCGA HNSC -0.186; TCGA KIRC -0.15; TCGA KIRP -0.346; TCGA LIHC -0.072; TCGA LUAD -0.197; TCGA LUSC -0.165; TCGA PAAD -0.211; TCGA PRAD -0.064; TCGA STAD -0.189; TCGA UCEC -0.159
hsa-miR-429
RIMKLB
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.118; TCGA CESC -0.175; TCGA COAD -0.584; TCGA ESCA -0.4; TCGA KIRC -0.059; TCGA KIRP -0.147; TCGA PAAD -0.157; TCGA STAD -0.331; TCGA UCEC -0.089
hsa-miR-429
CALU
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.18; TCGA CESC -0.113; TCGA COAD -0.211; TCGA ESCA -0.118; TCGA HNSC -0.2; TCGA KIRC -0.237; TCGA KIRP -0.174; TCGA LUAD -0.124; TCGA PAAD -0.145; TCGA PRAD -0.075; TCGA STAD -0.079; TCGA UCEC -0.096
hsa-miR-429
AP1S2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.289; TCGA BRCA -0.137; TCGA CESC -0.185; TCGA COAD -0.37; TCGA ESCA -0.311; TCGA HNSC -0.303; TCGA KIRC -0.229; TCGA KIRP -0.251; TCGA LUAD -0.216; TCGA LUSC -0.303; TCGA PAAD -0.31; TCGA PRAD -0.062; TCGA STAD -0.35; TCGA UCEC -0.169
hsa-miR-429
TES
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.121; TCGA CESC -0.1; TCGA COAD -0.059; TCGA ESCA -0.088; TCGA HNSC -0.105; TCGA KIRC -0.073; TCGA LUAD -0.055; TCGA LUSC -0.059; TCGA STAD -0.125
hsa-miR-429
YAP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.112; TCGA BRCA -0.174; TCGA CESC -0.204; TCGA COAD -0.064; TCGA ESCA -0.073; TCGA HNSC -0.111; TCGA LUAD -0.089; TCGA PAAD -0.15; TCGA PRAD -0.058; TCGA STAD -0.127; TCGA UCEC -0.113
hsa-miR-429
MTMR6
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; PAAD; PRAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.07; TCGA BRCA -0.078; TCGA CESC -0.079; TCGA HNSC -0.135; TCGA LUAD -0.11; TCGA LUSC -0.213; TCGA OV -0.055; TCGA PAAD -0.07; TCGA PRAD -0.057; TCGA UCEC -0.117
hsa-miR-429
TBX18
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; STAD
MirTarget; PITA; miRanda
TCGA BLCA -0.425; TCGA BRCA -0.355; TCGA CESC -0.394; TCGA COAD -0.434; TCGA ESCA -0.528; TCGA HNSC -0.285; TCGA KIRC -0.233; TCGA PAAD -0.238; TCGA STAD -0.452
hsa-miR-429
ERCC4
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.058; TCGA COAD -0.064; TCGA ESCA -0.061; TCGA HNSC -0.063; TCGA KIRP -0.087; TCGA LIHC -0.077; TCGA PAAD -0.131; TCGA STAD -0.082; TCGA UCEC -0.099
hsa-miR-429
GUCY1A2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.265; TCGA CESC -0.246; TCGA COAD -0.497; TCGA ESCA -0.181; TCGA HNSC -0.35; TCGA KIRC -0.258; TCGA LUAD -0.216; TCGA LUSC -0.34; TCGA PAAD -0.304; TCGA PRAD -0.076; TCGA THCA -0.057; TCGA STAD -0.082; TCGA UCEC -0.317
hsa-miR-429
ZCCHC24
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.332; TCGA BRCA -0.347; TCGA CESC -0.308; TCGA COAD -0.487; TCGA ESCA -0.362; TCGA HNSC -0.428; TCGA KIRC -0.092; TCGA KIRP -0.195; TCGA LIHC -0.063; TCGA LUAD -0.126; TCGA LUSC -0.395; TCGA OV -0.142; TCGA PAAD -0.325; TCGA PRAD -0.102; TCGA STAD -0.417; TCGA UCEC -0.431
hsa-miR-429
MARCH1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.179; TCGA CESC -0.149; TCGA COAD -0.308; TCGA ESCA -0.167; TCGA HNSC -0.305; TCGA KIRC -0.295; TCGA KIRP -0.207; TCGA LUAD -0.254; TCGA LUSC -0.388; TCGA PAAD -0.456; TCGA STAD -0.079; TCGA UCEC -0.059
hsa-miR-429
TFE3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.092; TCGA BRCA -0.083; TCGA CESC -0.081; TCGA COAD -0.081; TCGA ESCA -0.087; TCGA HNSC -0.08; TCGA KIRC -0.077; TCGA KIRP -0.137; TCGA PAAD -0.065; TCGA STAD -0.083; TCGA UCEC -0.056
hsa-miR-429
PLCL1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.318; TCGA BRCA -0.184; TCGA CESC -0.418; TCGA COAD -0.394; TCGA ESCA -0.257; TCGA HNSC -0.404; TCGA LUAD -0.13; TCGA LUSC -0.382; TCGA PAAD -0.337; TCGA PRAD -0.258; TCGA STAD -0.371; TCGA UCEC -0.446
hsa-miR-429
RGL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.224; TCGA BRCA -0.284; TCGA CESC -0.105; TCGA COAD -0.345; TCGA ESCA -0.203; TCGA HNSC -0.124; TCGA KIRC -0.153; TCGA KIRP -0.131; TCGA LUAD -0.08; TCGA LUSC -0.162; TCGA PAAD -0.334; TCGA PRAD -0.103; TCGA STAD -0.238; TCGA UCEC -0.165
hsa-miR-429
PRKACB
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.099; TCGA CESC -0.109; TCGA ESCA -0.102; TCGA HNSC -0.248; TCGA LIHC -0.084; TCGA LUAD -0.12; TCGA LUSC -0.156; TCGA PRAD -0.064; TCGA THCA -0.053; TCGA STAD -0.222; TCGA UCEC -0.2
hsa-miR-429
SGPP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.159; TCGA BRCA -0.149; TCGA CESC -0.388; TCGA COAD -0.08; TCGA ESCA -0.149; TCGA HNSC -0.237; TCGA KIRP -0.178; TCGA LUAD -0.085; TCGA LUSC -0.349; TCGA PAAD -0.097; TCGA PRAD -0.09; TCGA STAD -0.115; TCGA UCEC -0.175
hsa-miR-429
PPM1F
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.091; TCGA BRCA -0.149; TCGA CESC -0.214; TCGA COAD -0.138; TCGA ESCA -0.132; TCGA HNSC -0.094; TCGA KIRC -0.215; TCGA LUAD -0.114; TCGA LUSC -0.083; TCGA PAAD -0.176; TCGA PRAD -0.051; TCGA STAD -0.142; TCGA UCEC -0.22
hsa-miR-429
LHFP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.271; TCGA BRCA -0.385; TCGA CESC -0.301; TCGA COAD -0.571; TCGA ESCA -0.327; TCGA HNSC -0.338; TCGA KIRC -0.213; TCGA KIRP -0.172; TCGA LUAD -0.161; TCGA LUSC -0.395; TCGA PAAD -0.308; TCGA STAD -0.28; TCGA UCEC -0.333
hsa-miR-429
ZDHHC15
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.228; TCGA BRCA -0.214; TCGA COAD -0.705; TCGA ESCA -0.356; TCGA HNSC -0.147; TCGA LUSC -0.269; TCGA OV -0.167; TCGA PAAD -0.18; TCGA STAD -0.454; TCGA UCEC -0.293
hsa-miR-429
HPS5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.09; TCGA CESC -0.092; TCGA COAD -0.094; TCGA ESCA -0.062; TCGA HNSC -0.102; TCGA KIRP -0.138; TCGA LUAD -0.166; TCGA LUSC -0.168; TCGA PAAD -0.158; TCGA PRAD -0.059; TCGA UCEC -0.075
hsa-miR-429
SEC23A
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.174; TCGA BRCA -0.186; TCGA CESC -0.163; TCGA COAD -0.157; TCGA ESCA -0.159; TCGA HNSC -0.232; TCGA KIRC -0.214; TCGA KIRP -0.17; TCGA LIHC -0.096; TCGA LUAD -0.161; TCGA LUSC -0.145; TCGA OV -0.074; TCGA PAAD -0.171; TCGA PRAD -0.101; TCGA STAD -0.173; TCGA UCEC -0.188
hsa-miR-429
DDIT4L
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; STAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.313; TCGA BRCA -0.263; TCGA COAD -0.695; TCGA ESCA -0.351; TCGA HNSC -0.668; TCGA LIHC -0.075; TCGA PAAD -0.269; TCGA PRAD -0.225; TCGA STAD -0.4
hsa-miR-429
PRKCB
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.425; TCGA BRCA -0.177; TCGA CESC -0.362; TCGA COAD -0.62; TCGA ESCA -0.305; TCGA HNSC -0.301; TCGA KIRC -0.192; TCGA KIRP -0.256; TCGA LUAD -0.166; TCGA LUSC -0.491; TCGA PAAD -0.707; TCGA PRAD -0.119; TCGA THCA -0.117; TCGA STAD -0.412; TCGA UCEC -0.277
hsa-miR-429
ATXN1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.23; TCGA BRCA -0.083; TCGA COAD -0.154; TCGA ESCA -0.115; TCGA HNSC -0.159; TCGA KIRC -0.126; TCGA LUAD -0.065; TCGA PAAD -0.148; TCGA STAD -0.191; TCGA UCEC -0.102
hsa-miR-429
COPS8
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; OV; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.097; TCGA COAD -0.061; TCGA ESCA -0.067; TCGA HNSC -0.074; TCGA KIRP -0.152; TCGA OV -0.07; TCGA PAAD -0.097; TCGA STAD -0.072; TCGA UCEC -0.069
hsa-miR-429
ADCY2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; OV; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.253; TCGA BRCA -0.18; TCGA COAD -0.728; TCGA ESCA -0.513; TCGA HNSC -0.463; TCGA KIRC -0.246; TCGA OV -0.271; TCGA PRAD -0.091; TCGA STAD -0.508; TCGA UCEC -0.428
hsa-miR-429
GIT2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.064; TCGA BRCA -0.083; TCGA CESC -0.097; TCGA COAD -0.099; TCGA ESCA -0.096; TCGA HNSC -0.103; TCGA KIRC -0.277; TCGA KIRP -0.087; TCGA LUAD -0.102; TCGA LUSC -0.135; TCGA PAAD -0.152; TCGA STAD -0.126; TCGA UCEC -0.093
hsa-miR-429
PTHLH
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; PRAD; THCA; STAD
MirTarget; PITA; miRanda
TCGA BLCA -0.363; TCGA BRCA -0.193; TCGA CESC -0.344; TCGA COAD -0.698; TCGA ESCA -0.515; TCGA KIRC -1.018; TCGA PRAD -0.105; TCGA THCA -0.067; TCGA STAD -0.274
hsa-miR-429
F2RL2
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; OV; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.274; TCGA CESC -0.251; TCGA HNSC -0.359; TCGA KIRC -0.217; TCGA KIRP -0.865; TCGA LUAD -0.246; TCGA OV -0.201; TCGA PAAD -0.191; TCGA STAD -0.146; TCGA UCEC -0.098
hsa-miR-429
DENND5A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.198; TCGA BRCA -0.145; TCGA CESC -0.091; TCGA COAD -0.339; TCGA ESCA -0.274; TCGA HNSC -0.137; TCGA KIRC -0.183; TCGA KIRP -0.17; TCGA LUAD -0.154; TCGA LUSC -0.158; TCGA PAAD -0.239; TCGA PRAD -0.07; TCGA STAD -0.292; TCGA UCEC -0.115
hsa-miR-429
FHL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.593; TCGA BRCA -0.701; TCGA CESC -0.539; TCGA COAD -0.753; TCGA ESCA -0.519; TCGA HNSC -0.651; TCGA KIRC -0.253; TCGA LUAD -0.289; TCGA LUSC -0.586; TCGA PAAD -0.333; TCGA PRAD -0.173; TCGA THCA -0.085; TCGA STAD -0.662; TCGA UCEC -0.62
hsa-miR-429
SGIP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.229; TCGA BRCA -0.072; TCGA CESC -0.254; TCGA COAD -0.492; TCGA ESCA -0.185; TCGA HNSC -0.272; TCGA LUAD -0.126; TCGA LUSC -0.373; TCGA OV -0.228; TCGA PAAD -0.125; TCGA STAD -0.249; TCGA UCEC -0.173
hsa-miR-429
IFIT5
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.153; TCGA CESC -0.101; TCGA COAD -0.109; TCGA ESCA -0.06; TCGA HNSC -0.159; TCGA LUAD -0.116; TCGA LUSC -0.201; TCGA PAAD -0.094; TCGA STAD -0.069; TCGA UCEC -0.093
hsa-miR-429
TFPI
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.212; TCGA BRCA -0.399; TCGA CESC -0.355; TCGA COAD -0.374; TCGA HNSC -0.212; TCGA KIRC -0.22; TCGA LIHC -0.154; TCGA LUAD -0.18; TCGA LUSC -0.256; TCGA PRAD -0.087; TCGA STAD -0.128; TCGA UCEC -0.309
hsa-miR-429
LAMC1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.172; TCGA BRCA -0.25; TCGA CESC -0.107; TCGA COAD -0.224; TCGA ESCA -0.154; TCGA HNSC -0.179; TCGA KIRC -0.194; TCGA LUAD -0.105; TCGA LUSC -0.095; TCGA PAAD -0.145; TCGA STAD -0.21
hsa-miR-429
GPRASP2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUSC; OV; PRAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.135; TCGA BRCA -0.205; TCGA CESC -0.124; TCGA COAD -0.209; TCGA ESCA -0.186; TCGA KIRP -0.101; TCGA LIHC -0.08; TCGA LUSC -0.067; TCGA OV -0.095; TCGA PRAD -0.051; TCGA UCEC -0.36
hsa-miR-429
ITGA1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.276; TCGA BRCA -0.275; TCGA CESC -0.241; TCGA COAD -0.268; TCGA ESCA -0.146; TCGA HNSC -0.324; TCGA KIRC -0.232; TCGA KIRP -0.23; TCGA LIHC -0.064; TCGA LUAD -0.189; TCGA LUSC -0.461; TCGA PAAD -0.223; TCGA PRAD -0.167; TCGA STAD -0.302; TCGA UCEC -0.104
hsa-miR-429
TRIM23
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.071; TCGA BRCA -0.128; TCGA CESC -0.088; TCGA COAD -0.104; TCGA ESCA -0.144; TCGA HNSC -0.156; TCGA KIRC -0.07; TCGA KIRP -0.205; TCGA LIHC -0.077; TCGA LUAD -0.065; TCGA LUSC -0.141; TCGA OV -0.086; TCGA PAAD -0.109; TCGA STAD -0.151; TCGA UCEC -0.169
hsa-miR-429
NALCN
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.116; TCGA BRCA -0.213; TCGA CESC -0.27; TCGA COAD -0.909; TCGA ESCA -0.345; TCGA HNSC -0.326; TCGA LUAD -0.127; TCGA LUSC -0.446; TCGA OV -0.202; TCGA THCA -0.131; TCGA STAD -0.362; TCGA UCEC -0.246
hsa-miR-429
ELL2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.156; TCGA BRCA -0.095; TCGA CESC -0.157; TCGA COAD -0.105; TCGA ESCA -0.21; TCGA HNSC -0.157; TCGA KIRC -0.176; TCGA LIHC -0.105; TCGA LUAD -0.068; TCGA PRAD -0.055; TCGA STAD -0.173; TCGA UCEC -0.072
hsa-miR-429
FBXW11
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUSC; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.075; TCGA CESC -0.062; TCGA HNSC -0.076; TCGA KIRP -0.117; TCGA LUSC -0.114; TCGA PRAD -0.056; TCGA STAD -0.065; TCGA UCEC -0.093
hsa-miR-429
RNF38
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.075; TCGA CESC -0.058; TCGA ESCA -0.07; TCGA HNSC -0.064; TCGA LUSC -0.142; TCGA PAAD -0.079; TCGA STAD -0.158; TCGA UCEC -0.152
hsa-miR-429
MRVI1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.308; TCGA BRCA -0.28; TCGA CESC -0.35; TCGA COAD -0.592; TCGA ESCA -0.394; TCGA HNSC -0.276; TCGA LUAD -0.128; TCGA LUSC -0.404; TCGA PAAD -0.238; TCGA PRAD -0.13; TCGA STAD -0.486; TCGA UCEC -0.38
hsa-miR-429
CORO1C
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.267; TCGA BRCA -0.111; TCGA CESC -0.123; TCGA COAD -0.099; TCGA ESCA -0.156; TCGA HNSC -0.057; TCGA KIRC -0.255; TCGA KIRP -0.265; TCGA LUAD -0.234; TCGA LUSC -0.082; TCGA PAAD -0.155; TCGA PRAD -0.116; TCGA STAD -0.173; TCGA UCEC -0.15
hsa-miR-429
CACNA1C
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.293; TCGA BRCA -0.159; TCGA CESC -0.327; TCGA COAD -0.303; TCGA ESCA -0.25; TCGA HNSC -0.323; TCGA KIRC -0.18; TCGA LUAD -0.098; TCGA LUSC -0.38; TCGA STAD -0.46; TCGA UCEC -0.352
hsa-miR-429
DENND5B
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.308; TCGA BRCA -0.206; TCGA CESC -0.22; TCGA COAD -0.255; TCGA HNSC -0.338; TCGA KIRC -0.092; TCGA KIRP -0.266; TCGA LIHC -0.062; TCGA LUAD -0.108; TCGA LUSC -0.229; TCGA PAAD -0.162; TCGA STAD -0.053; TCGA UCEC -0.215
hsa-miR-429
RELN
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.463; TCGA BRCA -0.681; TCGA COAD -1.002; TCGA ESCA -0.783; TCGA HNSC -0.514; TCGA LUAD -0.301; TCGA LUSC -0.481; TCGA PAAD -0.365; TCGA PRAD -0.236; TCGA STAD -0.489; TCGA UCEC -0.391
hsa-miR-429
PHLDB1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.149; TCGA BRCA -0.214; TCGA CESC -0.117; TCGA COAD -0.17; TCGA ESCA -0.131; TCGA HNSC -0.309; TCGA LUSC -0.218; TCGA OV -0.092; TCGA PAAD -0.154; TCGA STAD -0.19; TCGA UCEC -0.091
hsa-miR-429
KIAA1462
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.283; TCGA BRCA -0.252; TCGA CESC -0.271; TCGA COAD -0.572; TCGA ESCA -0.159; TCGA HNSC -0.383; TCGA KIRC -0.18; TCGA LUAD -0.268; TCGA LUSC -0.532; TCGA OV -0.166; TCGA PAAD -0.182; TCGA PRAD -0.094; TCGA STAD -0.218; TCGA UCEC -0.419
hsa-miR-429
ENTPD1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.182; TCGA BRCA -0.062; TCGA CESC -0.17; TCGA COAD -0.299; TCGA ESCA -0.12; TCGA HNSC -0.148; TCGA KIRC -0.206; TCGA LUAD -0.134; TCGA LUSC -0.248; TCGA OV -0.066; TCGA PAAD -0.252; TCGA PRAD -0.083; TCGA STAD -0.169; TCGA UCEC -0.167
hsa-miR-429
CDK17
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.089; TCGA CESC -0.163; TCGA COAD -0.124; TCGA ESCA -0.176; TCGA HNSC -0.103; TCGA KIRC -0.178; TCGA LUAD -0.132; TCGA LUSC -0.087; TCGA PAAD -0.136; TCGA STAD -0.136; TCGA UCEC -0.161
hsa-miR-429
LPAR1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.194; TCGA BRCA -0.285; TCGA CESC -0.13; TCGA COAD -0.354; TCGA ESCA -0.291; TCGA HNSC -0.238; TCGA LUAD -0.113; TCGA LUSC -0.135; TCGA OV -0.169; TCGA PAAD -0.413; TCGA PRAD -0.054; TCGA THCA -0.059; TCGA STAD -0.271; TCGA UCEC -0.131
hsa-miR-429
SESN3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.128; TCGA BRCA -0.215; TCGA COAD -0.275; TCGA ESCA -0.273; TCGA HNSC -0.096; TCGA LIHC -0.138; TCGA PAAD -0.274; TCGA PRAD -0.087; TCGA THCA -0.061; TCGA STAD -0.217
hsa-miR-429
FSCN1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.067; TCGA CESC -0.382; TCGA COAD -0.265; TCGA ESCA -0.27; TCGA HNSC -0.106; TCGA KIRC -0.348; TCGA LUAD -0.157; TCGA PRAD -0.079; TCGA UCEC -0.08
hsa-miR-429
ACTC1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.995; TCGA BRCA -0.267; TCGA CESC -0.395; TCGA COAD -0.962; TCGA ESCA -0.432; TCGA HNSC -1.212; TCGA KIRP -0.438; TCGA LUSC -0.304; TCGA OV -0.436; TCGA PAAD -0.364; TCGA PRAD -0.252; TCGA STAD -0.532; TCGA UCEC -0.318
hsa-miR-429
SYNC
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD
MirTarget; miRanda
TCGA BLCA -0.184; TCGA CESC -0.217; TCGA COAD -0.619; TCGA ESCA -0.464; TCGA HNSC -0.262; TCGA LUSC -0.324; TCGA PAAD -0.266; TCGA PRAD -0.08; TCGA STAD -0.144
hsa-miR-429
MEGF10
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; OV; PRAD; STAD; UCEC
MirTarget; PITA
TCGA BLCA -0.132; TCGA BRCA -0.133; TCGA COAD -0.364; TCGA ESCA -0.27; TCGA HNSC -0.248; TCGA OV -0.3; TCGA PRAD -0.142; TCGA STAD -0.268; TCGA UCEC -0.285
hsa-miR-429
PICALM
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.053; TCGA BRCA -0.105; TCGA CESC -0.149; TCGA COAD -0.059; TCGA HNSC -0.11; TCGA KIRP -0.051; TCGA LUAD -0.106; TCGA LUSC -0.084; TCGA PAAD -0.081; TCGA STAD -0.051; TCGA UCEC -0.073
hsa-miR-429
ARHGAP20
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.402; TCGA BRCA -0.576; TCGA CESC -0.438; TCGA COAD -0.672; TCGA ESCA -0.446; TCGA HNSC -0.33; TCGA KIRC -0.161; TCGA KIRP -0.182; TCGA LUAD -0.167; TCGA LUSC -0.327; TCGA PAAD -0.356; TCGA PRAD -0.109; TCGA STAD -0.46; TCGA UCEC -0.516
hsa-miR-429
MSN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.375; TCGA BRCA -0.121; TCGA CESC -0.447; TCGA COAD -0.421; TCGA ESCA -0.333; TCGA HNSC -0.232; TCGA KIRC -0.106; TCGA KIRP -0.168; TCGA LUAD -0.195; TCGA LUSC -0.239; TCGA PAAD -0.278; TCGA PRAD -0.097; TCGA STAD -0.206; TCGA UCEC -0.124
hsa-miR-429
FAM155A
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.128; TCGA BRCA -0.127; TCGA CESC -0.203; TCGA COAD -0.615; TCGA HNSC -0.352; TCGA LUAD -0.148; TCGA LUSC -0.45; TCGA STAD -0.141; TCGA UCEC -0.138
hsa-miR-429
MAP2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.136; TCGA COAD -0.554; TCGA ESCA -0.21; TCGA HNSC -0.25; TCGA KIRC -0.115; TCGA KIRP -0.223; TCGA LIHC -0.14; TCGA LUSC -0.242; TCGA OV -0.221; TCGA PRAD -0.207; TCGA STAD -0.325
hsa-miR-429
DIXDC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.387; TCGA BRCA -0.243; TCGA CESC -0.165; TCGA COAD -0.31; TCGA ESCA -0.248; TCGA HNSC -0.268; TCGA KIRC -0.07; TCGA KIRP -0.123; TCGA LUAD -0.104; TCGA LUSC -0.319; TCGA OV -0.092; TCGA PAAD -0.171; TCGA PRAD -0.112; TCGA STAD -0.416; TCGA UCEC -0.326
hsa-miR-429
RBM20
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.14; TCGA COAD -0.389; TCGA ESCA -0.199; TCGA KIRC -0.157; TCGA KIRP -0.384; TCGA LIHC -0.164; TCGA STAD -0.491; TCGA UCEC -0.237
hsa-miR-429
GJC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.213; TCGA BRCA -0.126; TCGA CESC -0.218; TCGA COAD -0.434; TCGA ESCA -0.266; TCGA HNSC -0.217; TCGA KIRC -0.57; TCGA KIRP -0.255; TCGA LUAD -0.193; TCGA LUSC -0.138; TCGA PAAD -0.215; TCGA PRAD -0.136; TCGA STAD -0.403; TCGA UCEC -0.388
hsa-miR-429
FOXF1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.207; TCGA BRCA -0.108; TCGA COAD -0.32; TCGA ESCA -0.215; TCGA HNSC -0.129; TCGA KIRC -0.227; TCGA LUAD -0.16; TCGA LUSC -0.416; TCGA OV -0.108; TCGA PAAD -0.144; TCGA PRAD -0.109; TCGA STAD -0.383; TCGA UCEC -0.135
hsa-miR-429
FRMD4A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.147; TCGA CESC -0.122; TCGA COAD -0.211; TCGA ESCA -0.163; TCGA HNSC -0.147; TCGA KIRC -0.053; TCGA LUAD -0.174; TCGA LUSC -0.218; TCGA PAAD -0.275; TCGA STAD -0.21
hsa-miR-429
PCDH10
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.296; TCGA BRCA -0.214; TCGA CESC -0.193; TCGA ESCA -0.632; TCGA HNSC -0.402; TCGA LUAD -0.224; TCGA LUSC -0.228; TCGA PRAD -0.114; TCGA STAD -0.926; TCGA UCEC -0.36
hsa-miR-429
SIRPA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.354; TCGA BRCA -0.192; TCGA CESC -0.391; TCGA COAD -0.318; TCGA ESCA -0.267; TCGA HNSC -0.322; TCGA KIRC -0.272; TCGA KIRP -0.258; TCGA LUAD -0.301; TCGA LUSC -0.402; TCGA PAAD -0.278; TCGA UCEC -0.149
hsa-miR-429
ZNF532
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.094; TCGA CESC -0.162; TCGA COAD -0.401; TCGA ESCA -0.224; TCGA HNSC -0.131; TCGA KIRC -0.233; TCGA LUAD -0.075; TCGA PAAD -0.23; TCGA PRAD -0.092; TCGA STAD -0.234; TCGA UCEC -0.135
hsa-miR-429
MPRIP
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.106; TCGA CESC -0.093; TCGA COAD -0.07; TCGA HNSC -0.137; TCGA KIRC -0.062; TCGA LUSC -0.133; TCGA PAAD -0.077; TCGA STAD -0.094; TCGA UCEC -0.127
hsa-miR-429
ARHGAP28
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.106; TCGA BRCA -0.291; TCGA CESC -0.19; TCGA COAD -0.326; TCGA ESCA -0.243; TCGA HNSC -0.412; TCGA LUAD -0.201; TCGA LUSC -0.177; TCGA OV -0.209; TCGA PAAD -0.462; TCGA PRAD -0.157; TCGA THCA -0.063; TCGA STAD -0.153; TCGA UCEC -0.22
hsa-miR-429
ST3GAL2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.122; TCGA CESC -0.177; TCGA COAD -0.081; TCGA HNSC -0.294; TCGA KIRC -0.166; TCGA KIRP -0.161; TCGA LUAD -0.143; TCGA LUSC -0.22; TCGA PAAD -0.117; TCGA STAD -0.112; TCGA UCEC -0.156
hsa-miR-429
ARHGEF3
10 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.105; TCGA CESC -0.062; TCGA COAD -0.129; TCGA HNSC -0.051; TCGA LUAD -0.14; TCGA LUSC -0.222; TCGA OV -0.085; TCGA PAAD -0.067; TCGA STAD -0.075; TCGA UCEC -0.061
hsa-miR-429
ETV5
9 cancers: BLCA; BRCA; KIRC; KIRP; LUSC; OV; PAAD; PRAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.18; TCGA BRCA -0.128; TCGA KIRC -0.12; TCGA KIRP -0.243; TCGA LUSC -0.142; TCGA OV -0.175; TCGA PAAD -0.064; TCGA PRAD -0.059; TCGA UCEC -0.071
hsa-miR-429
JAZF1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.353; TCGA BRCA -0.186; TCGA CESC -0.314; TCGA COAD -0.452; TCGA ESCA -0.228; TCGA HNSC -0.279; TCGA KIRC -0.233; TCGA KIRP -0.226; TCGA LIHC -0.079; TCGA LUAD -0.103; TCGA LUSC -0.264; TCGA PAAD -0.14; TCGA PRAD -0.114; TCGA STAD -0.262; TCGA UCEC -0.211
hsa-miR-429
ASAP1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.063; TCGA CESC -0.117; TCGA COAD -0.155; TCGA ESCA -0.17; TCGA HNSC -0.098; TCGA KIRC -0.269; TCGA KIRP -0.284; TCGA LUAD -0.167; TCGA LUSC -0.063; TCGA PAAD -0.195; TCGA PRAD -0.098; TCGA STAD -0.101; TCGA UCEC -0.118
hsa-miR-429
KCTD15
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.209; TCGA CESC -0.195; TCGA COAD -0.312; TCGA ESCA -0.31; TCGA KIRC -0.158; TCGA KIRP -0.256; TCGA LUAD -0.103; TCGA PAAD -0.101; TCGA STAD -0.269; TCGA UCEC -0.282
hsa-miR-429
MPDZ
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.123; TCGA BRCA -0.225; TCGA CESC -0.278; TCGA COAD -0.703; TCGA ESCA -0.397; TCGA HNSC -0.312; TCGA KIRP -0.111; TCGA LIHC -0.206; TCGA LUAD -0.116; TCGA LUSC -0.293; TCGA OV -0.116; TCGA PAAD -0.31; TCGA PRAD -0.051; TCGA STAD -0.457; TCGA UCEC -0.195
hsa-miR-429
RND3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.185; TCGA BRCA -0.208; TCGA CESC -0.165; TCGA ESCA -0.188; TCGA HNSC -0.111; TCGA KIRC -0.114; TCGA KIRP -0.125; TCGA LUAD -0.183; TCGA PAAD -0.13; TCGA STAD -0.079; TCGA UCEC -0.099
hsa-miR-429
WWC3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.145; TCGA CESC -0.098; TCGA COAD -0.107; TCGA ESCA -0.216; TCGA HNSC -0.072; TCGA KIRC -0.185; TCGA KIRP -0.126; TCGA LUSC -0.158; TCGA PAAD -0.115; TCGA STAD -0.256; TCGA UCEC -0.119
hsa-miR-429
CHRDL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.696; TCGA BRCA -0.747; TCGA CESC -0.621; TCGA COAD -1.47; TCGA ESCA -0.866; TCGA HNSC -0.592; TCGA KIRP -0.419; TCGA LUAD -0.229; TCGA LUSC -0.809; TCGA OV -0.363; TCGA PAAD -0.764; TCGA PRAD -0.188; TCGA STAD -0.857; TCGA UCEC -0.746
hsa-miR-429
ZMAT3
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.086; TCGA BRCA -0.19; TCGA COAD -0.211; TCGA HNSC -0.106; TCGA KIRP -0.145; TCGA LUAD -0.105; TCGA LUSC -0.11; TCGA PAAD -0.217; TCGA PRAD -0.14; TCGA STAD -0.116; TCGA UCEC -0.057
hsa-miR-429
CFL2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.39; TCGA BRCA -0.261; TCGA CESC -0.158; TCGA COAD -0.51; TCGA ESCA -0.356; TCGA HNSC -0.42; TCGA KIRC -0.053; TCGA KIRP -0.248; TCGA LIHC -0.14; TCGA LUAD -0.226; TCGA LUSC -0.3; TCGA PAAD -0.221; TCGA PRAD -0.171; TCGA THCA -0.071; TCGA STAD -0.514; TCGA UCEC -0.302
hsa-miR-429
FLI1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.278; TCGA BRCA -0.261; TCGA CESC -0.436; TCGA COAD -0.455; TCGA ESCA -0.227; TCGA HNSC -0.353; TCGA KIRC -0.287; TCGA LUAD -0.229; TCGA LUSC -0.518; TCGA PAAD -0.44; TCGA PRAD -0.073; TCGA STAD -0.154; TCGA UCEC -0.264
hsa-miR-429
POLK
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.114; TCGA ESCA -0.068; TCGA HNSC -0.115; TCGA KIRP -0.114; TCGA LIHC -0.055; TCGA LUAD -0.089; TCGA LUSC -0.158; TCGA STAD -0.104; TCGA UCEC -0.084
hsa-miR-429
CNTN1
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.556; TCGA BRCA -0.446; TCGA COAD -1.215; TCGA ESCA -0.824; TCGA LUAD -0.258; TCGA PAAD -0.215; TCGA PRAD -0.146; TCGA STAD -0.794; TCGA UCEC -0.208
hsa-miR-429
DOCK4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.194; TCGA CESC -0.287; TCGA COAD -0.334; TCGA ESCA -0.121; TCGA HNSC -0.259; TCGA KIRC -0.216; TCGA KIRP -0.159; TCGA LUAD -0.172; TCGA LUSC -0.342; TCGA PAAD -0.204; TCGA STAD -0.138; TCGA UCEC -0.248
hsa-miR-429
GREM1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.503; TCGA CESC -0.366; TCGA COAD -0.988; TCGA ESCA -0.578; TCGA HNSC -0.291; TCGA KIRP -0.38; TCGA LUAD -0.167; TCGA LUSC -0.209; TCGA PAAD -0.467; TCGA STAD -0.45; TCGA UCEC -0.285
hsa-miR-429
MARCH8
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget
TCGA BLCA -0.112; TCGA BRCA -0.201; TCGA ESCA -0.066; TCGA HNSC -0.173; TCGA KIRP -0.161; TCGA LIHC -0.07; TCGA LUAD -0.102; TCGA LUSC -0.246; TCGA PAAD -0.125; TCGA STAD -0.11; TCGA UCEC -0.174
hsa-miR-429
BCAP29
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.065; TCGA COAD -0.065; TCGA ESCA -0.079; TCGA HNSC -0.069; TCGA KIRC -0.13; TCGA LUAD -0.108; TCGA LUSC -0.087; TCGA STAD -0.085; TCGA UCEC -0.133
hsa-miR-429
TFEC
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.369; TCGA CESC -0.321; TCGA COAD -0.496; TCGA ESCA -0.277; TCGA HNSC -0.329; TCGA KIRC -0.183; TCGA LUAD -0.302; TCGA LUSC -0.573; TCGA PAAD -0.512
hsa-miR-429
HIPK3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.177; TCGA BRCA -0.258; TCGA COAD -0.184; TCGA ESCA -0.123; TCGA HNSC -0.335; TCGA LUAD -0.133; TCGA LUSC -0.178; TCGA PAAD -0.171; TCGA PRAD -0.145; TCGA STAD -0.198; TCGA UCEC -0.158
hsa-miR-429
ARL15
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.056; TCGA BRCA -0.18; TCGA CESC -0.141; TCGA COAD -0.07; TCGA ESCA -0.08; TCGA HNSC -0.225; TCGA LUSC -0.088; TCGA PAAD -0.09; TCGA UCEC -0.13
hsa-miR-429
SYNM
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.572; TCGA BRCA -0.428; TCGA CESC -0.275; TCGA COAD -0.913; TCGA ESCA -0.68; TCGA HNSC -0.271; TCGA KIRC -0.23; TCGA KIRP -0.304; TCGA LUAD -0.154; TCGA LUSC -0.097; TCGA PAAD -0.387; TCGA PRAD -0.107; TCGA STAD -0.923; TCGA UCEC -0.391
hsa-miR-429
TCP11L1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.222; TCGA BRCA -0.065; TCGA CESC -0.186; TCGA COAD -0.135; TCGA ESCA -0.152; TCGA HNSC -0.146; TCGA KIRC -0.175; TCGA KIRP -0.162; TCGA LIHC -0.051; TCGA LUAD -0.069; TCGA PAAD -0.119; TCGA STAD -0.177; TCGA UCEC -0.11
hsa-miR-429
GLI3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.222; TCGA BRCA -0.125; TCGA CESC -0.575; TCGA COAD -0.834; TCGA ESCA -0.512; TCGA HNSC -0.266; TCGA KIRC -0.194; TCGA LUAD -0.124; TCGA PAAD -0.368; TCGA STAD -0.403; TCGA UCEC -0.4
hsa-miR-429
NR3C1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.33; TCGA BRCA -0.333; TCGA CESC -0.241; TCGA COAD -0.499; TCGA ESCA -0.294; TCGA HNSC -0.147; TCGA KIRC -0.221; TCGA KIRP -0.166; TCGA LIHC -0.062; TCGA LUAD -0.154; TCGA LUSC -0.193; TCGA PAAD -0.213; TCGA STAD -0.259; TCGA UCEC -0.34
hsa-miR-429
PMP22
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.283; TCGA BRCA -0.172; TCGA CESC -0.314; TCGA COAD -0.449; TCGA ESCA -0.235; TCGA HNSC -0.36; TCGA KIRC -0.253; TCGA LUAD -0.241; TCGA LUSC -0.394; TCGA PAAD -0.276; TCGA PRAD -0.107; TCGA STAD -0.25; TCGA UCEC -0.383
hsa-miR-429
PTEN
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.06; TCGA BRCA -0.134; TCGA CESC -0.085; TCGA HNSC -0.151; TCGA LUAD -0.1; TCGA LUSC -0.222; TCGA PAAD -0.122; TCGA PRAD -0.121; TCGA STAD -0.078; TCGA UCEC -0.104
hsa-miR-429
NCAM1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; OV; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.611; TCGA BRCA -0.391; TCGA CESC -0.323; TCGA COAD -0.537; TCGA ESCA -0.492; TCGA HNSC -0.698; TCGA OV -0.215; TCGA PRAD -0.163; TCGA THCA -0.199; TCGA STAD -0.53; TCGA UCEC -0.55
hsa-miR-429
ALDH1A3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.078; TCGA BRCA -0.223; TCGA CESC -0.257; TCGA COAD -0.552; TCGA ESCA -0.277; TCGA LUAD -0.202; TCGA LUSC -0.149; TCGA PAAD -0.252; TCGA PRAD -0.111; TCGA STAD -0.228; TCGA UCEC -0.142
hsa-miR-429
CACNB2
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.175; TCGA BRCA -0.068; TCGA CESC -0.289; TCGA ESCA -0.283; TCGA HNSC -0.149; TCGA LUSC -0.179; TCGA THCA -0.079; TCGA STAD -0.509; TCGA UCEC -0.43
hsa-miR-429
PAM
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.231; TCGA BRCA -0.171; TCGA COAD -0.252; TCGA ESCA -0.154; TCGA HNSC -0.175; TCGA KIRC -0.051; TCGA KIRP -0.086; TCGA LUSC -0.19; TCGA PRAD -0.065; TCGA STAD -0.194
hsa-miR-429
PTGFR
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
PITA
TCGA BLCA -0.546; TCGA BRCA -0.522; TCGA CESC -0.554; TCGA COAD -0.691; TCGA ESCA -0.38; TCGA HNSC -0.615; TCGA LUAD -0.204; TCGA LUSC -0.408; TCGA OV -0.259; TCGA PAAD -0.453; TCGA STAD -0.441; TCGA UCEC -0.751
hsa-miR-429
ITSN1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.265; TCGA COAD -0.11; TCGA HNSC -0.102; TCGA KIRP -0.091; TCGA LUAD -0.079; TCGA LUSC -0.131; TCGA PAAD -0.119; TCGA PRAD -0.081; TCGA STAD -0.098; TCGA UCEC -0.119
hsa-miR-429
GDF6
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.283; TCGA BRCA -0.195; TCGA CESC -0.537; TCGA COAD -1.003; TCGA ESCA -0.674; TCGA HNSC -0.236; TCGA KIRC -0.68; TCGA KIRP -0.394; TCGA LUAD -0.322; TCGA LUSC -0.313; TCGA OV -0.408; TCGA PAAD -0.413; TCGA STAD -0.496; TCGA UCEC -0.364
hsa-miR-429
AKAP2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.509; TCGA BRCA -0.36; TCGA CESC -0.442; TCGA COAD -0.455; TCGA ESCA -0.23; TCGA HNSC -0.613; TCGA LUAD -0.359; TCGA LUSC -0.698; TCGA OV -0.096; TCGA PAAD -0.371; TCGA PRAD -0.138; TCGA UCEC -0.432
hsa-miR-429
CREB5
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.406; TCGA BRCA -0.315; TCGA COAD -0.294; TCGA ESCA -0.194; TCGA HNSC -0.246; TCGA KIRC -0.234; TCGA LUSC -0.154; TCGA PAAD -0.203; TCGA STAD -0.266
hsa-miR-429
KCNK2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.37; TCGA BRCA -0.165; TCGA COAD -0.942; TCGA ESCA -0.382; TCGA HNSC -0.333; TCGA OV -0.391; TCGA PAAD -0.385; TCGA PRAD -0.141; TCGA STAD -0.47; TCGA UCEC -0.209
hsa-miR-429
KLF10
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.188; TCGA BRCA -0.189; TCGA CESC -0.108; TCGA ESCA -0.16; TCGA HNSC -0.25; TCGA LUAD -0.112; TCGA LUSC -0.178; TCGA PAAD -0.065; TCGA STAD -0.211; TCGA UCEC -0.1
hsa-miR-429
FEZ2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.107; TCGA BRCA -0.165; TCGA CESC -0.079; TCGA COAD -0.116; TCGA ESCA -0.094; TCGA HNSC -0.126; TCGA KIRP -0.082; TCGA LUAD -0.105; TCGA LUSC -0.1; TCGA PAAD -0.085; TCGA PRAD -0.085; TCGA STAD -0.152; TCGA UCEC -0.154
hsa-miR-429
DACT1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.333; TCGA BRCA -0.132; TCGA CESC -0.236; TCGA COAD -0.414; TCGA ESCA -0.182; TCGA HNSC -0.563; TCGA LUAD -0.146; TCGA LUSC -0.47; TCGA PAAD -0.209; TCGA THCA -0.052; TCGA STAD -0.176; TCGA UCEC -0.242
hsa-miR-429
ZBTB38
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.102; TCGA BRCA -0.139; TCGA CESC -0.109; TCGA ESCA -0.074; TCGA HNSC -0.132; TCGA KIRP -0.152; TCGA LUAD -0.135; TCGA LUSC -0.073; TCGA PAAD -0.149; TCGA STAD -0.118; TCGA UCEC -0.172
hsa-miR-429
SCN3A
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.193; TCGA BRCA -0.6; TCGA CESC -0.303; TCGA COAD -0.423; TCGA ESCA -0.28; TCGA HNSC -0.275; TCGA LUSC -0.248; TCGA PAAD -0.299; TCGA STAD -0.201; TCGA UCEC -0.254
hsa-miR-429
TCF4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.231; TCGA BRCA -0.284; TCGA CESC -0.111; TCGA COAD -0.484; TCGA ESCA -0.194; TCGA HNSC -0.209; TCGA KIRC -0.282; TCGA LUAD -0.169; TCGA LUSC -0.134; TCGA OV -0.131; TCGA PAAD -0.347; TCGA PRAD -0.071; TCGA STAD -0.214; TCGA UCEC -0.212
hsa-miR-429
MCC
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.2; TCGA CESC -0.426; TCGA COAD -0.54; TCGA ESCA -0.375; TCGA HNSC -0.107; TCGA LUAD -0.162; TCGA PAAD -0.197; TCGA STAD -0.314; TCGA UCEC -0.216
hsa-miR-429
SGCE
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.275; TCGA BRCA -0.225; TCGA COAD -0.627; TCGA ESCA -0.25; TCGA HNSC -0.22; TCGA LUAD -0.174; TCGA LUSC -0.311; TCGA OV -0.14; TCGA PAAD -0.167; TCGA PRAD -0.063; TCGA STAD -0.335; TCGA UCEC -0.348
hsa-miR-429
ITPR1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.221; TCGA CESC -0.332; TCGA COAD -0.503; TCGA ESCA -0.317; TCGA HNSC -0.186; TCGA LUAD -0.144; TCGA LUSC -0.342; TCGA PAAD -0.305; TCGA STAD -0.303; TCGA UCEC -0.369
hsa-miR-429
KIF13A
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.137; TCGA BRCA -0.177; TCGA CESC -0.134; TCGA ESCA -0.081; TCGA HNSC -0.179; TCGA LUAD -0.082; TCGA LUSC -0.092; TCGA PRAD -0.065; TCGA STAD -0.096; TCGA UCEC -0.141
hsa-miR-429
PRDM1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.157; TCGA BRCA -0.062; TCGA CESC -0.194; TCGA COAD -0.164; TCGA HNSC -0.138; TCGA KIRC -0.488; TCGA KIRP -0.14; TCGA LUAD -0.161; TCGA LUSC -0.2; TCGA PAAD -0.239; TCGA PRAD -0.09; TCGA UCEC -0.136
hsa-miR-429
KLF9
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.353; TCGA BRCA -0.294; TCGA CESC -0.207; TCGA COAD -0.335; TCGA ESCA -0.229; TCGA HNSC -0.23; TCGA LIHC -0.157; TCGA LUAD -0.145; TCGA LUSC -0.363; TCGA PAAD -0.197; TCGA PRAD -0.06; TCGA STAD -0.343; TCGA UCEC -0.267
hsa-miR-429
TNFSF8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.414; TCGA BRCA -0.096; TCGA CESC -0.268; TCGA COAD -0.586; TCGA ESCA -0.234; TCGA HNSC -0.429; TCGA KIRC -0.441; TCGA KIRP -0.341; TCGA LUAD -0.264; TCGA LUSC -0.618; TCGA PAAD -0.652; TCGA PRAD -0.104; TCGA STAD -0.169
hsa-miR-429
CREBL2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.087; TCGA BRCA -0.152; TCGA CESC -0.101; TCGA COAD -0.058; TCGA ESCA -0.068; TCGA HNSC -0.109; TCGA KIRP -0.131; TCGA LIHC -0.063; TCGA LUAD -0.097; TCGA LUSC -0.185; TCGA PAAD -0.079; TCGA STAD -0.102; TCGA UCEC -0.131
hsa-miR-429
NDST1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.122; TCGA BRCA -0.081; TCGA CESC -0.166; TCGA COAD -0.103; TCGA ESCA -0.154; TCGA HNSC -0.213; TCGA KIRC -0.1; TCGA LUAD -0.098; TCGA LUSC -0.21; TCGA PAAD -0.139; TCGA STAD -0.103; TCGA UCEC -0.061
hsa-miR-429
AHNAK
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.195; TCGA BRCA -0.299; TCGA CESC -0.18; TCGA COAD -0.204; TCGA ESCA -0.167; TCGA HNSC -0.217; TCGA LUAD -0.26; TCGA LUSC -0.189; TCGA PAAD -0.089; TCGA PRAD -0.087; TCGA STAD -0.269; TCGA UCEC -0.24
hsa-miR-429
CDH11
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.299; TCGA CESC -0.312; TCGA COAD -0.557; TCGA ESCA -0.266; TCGA HNSC -0.435; TCGA KIRC -0.357; TCGA LUAD -0.234; TCGA LUSC -0.422; TCGA PAAD -0.391; TCGA PRAD -0.077; TCGA STAD -0.187; TCGA UCEC -0.222
hsa-miR-429
CNTFR
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.276; TCGA BRCA -0.573; TCGA CESC -0.371; TCGA COAD -0.373; TCGA ESCA -0.405; TCGA HNSC -0.251; TCGA LUSC -0.226; TCGA PAAD -0.556; TCGA PRAD -0.138; TCGA STAD -0.231; TCGA UCEC -0.408
hsa-miR-429
EGR1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.321; TCGA BRCA -0.44; TCGA CESC -0.157; TCGA COAD -0.151; TCGA ESCA -0.278; TCGA HNSC -0.111; TCGA LUAD -0.132; TCGA LUSC -0.31; TCGA PRAD -0.102; TCGA STAD -0.204; TCGA UCEC -0.235
hsa-miR-429
KDR
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.065; TCGA BRCA -0.245; TCGA CESC -0.255; TCGA COAD -0.23; TCGA HNSC -0.272; TCGA KIRC -0.203; TCGA LUAD -0.111; TCGA LUSC -0.442; TCGA PAAD -0.196; TCGA PRAD -0.164; TCGA UCEC -0.273
hsa-miR-429
LRP1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.223; TCGA BRCA -0.354; TCGA CESC -0.221; TCGA COAD -0.145; TCGA ESCA -0.165; TCGA HNSC -0.229; TCGA KIRC -0.227; TCGA KIRP -0.157; TCGA LIHC -0.103; TCGA LUAD -0.161; TCGA LUSC -0.223; TCGA PAAD -0.208; TCGA STAD -0.155; TCGA UCEC -0.251
hsa-miR-429
PPP1R12B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.245; TCGA BRCA -0.316; TCGA CESC -0.294; TCGA COAD -0.5; TCGA ESCA -0.315; TCGA HNSC -0.228; TCGA LUSC -0.175; TCGA PAAD -0.169; TCGA PRAD -0.113; TCGA STAD -0.542; TCGA UCEC -0.474
hsa-miR-429
NPTX1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.204; TCGA BRCA -0.166; TCGA CESC -0.447; TCGA COAD -1.12; TCGA ESCA -0.806; TCGA LUSC -0.259; TCGA PRAD -0.083; TCGA STAD -0.849; TCGA UCEC -0.182
hsa-miR-429
PRKAR2B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.187; TCGA BRCA -0.297; TCGA CESC -0.136; TCGA COAD -0.407; TCGA ESCA -0.369; TCGA HNSC -0.183; TCGA LUSC -0.126; TCGA PAAD -0.228; TCGA PRAD -0.095; TCGA STAD -0.397; TCGA UCEC -0.345
hsa-miR-429
RDX
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.093; TCGA BRCA -0.128; TCGA CESC -0.084; TCGA COAD -0.489; TCGA ESCA -0.307; TCGA HNSC -0.134; TCGA LUAD -0.179; TCGA LUSC -0.133; TCGA PAAD -0.248; TCGA STAD -0.246; TCGA UCEC -0.08
hsa-miR-429
SDC2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.174; TCGA CESC -0.23; TCGA COAD -0.492; TCGA ESCA -0.241; TCGA HNSC -0.351; TCGA LUSC -0.292; TCGA OV -0.124; TCGA PAAD -0.158; TCGA PRAD -0.095; TCGA STAD -0.231; TCGA UCEC -0.187
hsa-miR-429
SNAI2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.244; TCGA BRCA -0.22; TCGA CESC -0.556; TCGA COAD -0.438; TCGA ESCA -0.393; TCGA HNSC -0.175; TCGA KIRC -0.16; TCGA LIHC -0.124; TCGA LUAD -0.34; TCGA PAAD -0.315; TCGA PRAD -0.082; TCGA STAD -0.143; TCGA UCEC -0.343
hsa-miR-429
TIMP2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.376; TCGA BRCA -0.231; TCGA CESC -0.308; TCGA COAD -0.603; TCGA ESCA -0.26; TCGA HNSC -0.407; TCGA KIRC -0.076; TCGA KIRP -0.203; TCGA LUAD -0.246; TCGA LUSC -0.465; TCGA OV -0.101; TCGA PAAD -0.221; TCGA PRAD -0.103; TCGA STAD -0.276; TCGA UCEC -0.351
hsa-miR-429
IRS2
9 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUSC; OV; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.252; TCGA HNSC -0.078; TCGA KIRP -0.149; TCGA LIHC -0.112; TCGA LUSC -0.325; TCGA OV -0.177; TCGA STAD -0.125; TCGA UCEC -0.359
hsa-miR-429
NRP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.439; TCGA BRCA -0.159; TCGA CESC -0.164; TCGA COAD -0.594; TCGA ESCA -0.346; TCGA HNSC -0.146; TCGA KIRC -0.389; TCGA KIRP -0.254; TCGA LUAD -0.205; TCGA LUSC -0.319; TCGA PAAD -0.206; TCGA PRAD -0.156; TCGA STAD -0.413; TCGA UCEC -0.238
hsa-miR-429
EGR3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.418; TCGA BRCA -0.313; TCGA COAD -0.413; TCGA ESCA -0.245; TCGA HNSC -0.222; TCGA LUAD -0.115; TCGA LUSC -0.364; TCGA PAAD -0.143; TCGA PRAD -0.135; TCGA STAD -0.215; TCGA UCEC -0.101
hsa-miR-429
ROR2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.578; TCGA CESC -0.539; TCGA COAD -0.718; TCGA ESCA -0.475; TCGA HNSC -0.316; TCGA LUAD -0.198; TCGA LUSC -0.242; TCGA PAAD -0.289; TCGA THCA -0.091; TCGA STAD -0.498; TCGA UCEC -0.167
hsa-miR-429
MAP4K4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.134; TCGA BRCA -0.11; TCGA CESC -0.104; TCGA COAD -0.139; TCGA ESCA -0.084; TCGA HNSC -0.115; TCGA KIRC -0.316; TCGA KIRP -0.122; TCGA LUAD -0.088; TCGA LUSC -0.065; TCGA PAAD -0.083
hsa-miR-429
PIP4K2A
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.051; TCGA COAD -0.241; TCGA ESCA -0.106; TCGA HNSC -0.107; TCGA KIRC -0.177; TCGA KIRP -0.177; TCGA LUAD -0.165; TCGA LUSC -0.204; TCGA PAAD -0.285; TCGA PRAD -0.066; TCGA STAD -0.137
hsa-miR-429
PLS3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.117; TCGA BRCA -0.223; TCGA CESC -0.253; TCGA COAD -0.2; TCGA ESCA -0.166; TCGA HNSC -0.067; TCGA KIRP -0.261; TCGA LUAD -0.159; TCGA LUSC -0.089; TCGA PAAD -0.083; TCGA PRAD -0.077; TCGA STAD -0.075; TCGA UCEC -0.176
hsa-miR-429
GPM6A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.472; TCGA BRCA -0.425; TCGA CESC -0.378; TCGA COAD -1.417; TCGA ESCA -0.844; TCGA HNSC -0.299; TCGA LUAD -0.377; TCGA LUSC -0.822; TCGA PAAD -0.492; TCGA PRAD -0.204; TCGA STAD -0.78; TCGA UCEC -0.795
hsa-miR-429
LHFPL2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.113; TCGA BRCA -0.108; TCGA CESC -0.154; TCGA COAD -0.107; TCGA ESCA -0.098; TCGA HNSC -0.255; TCGA KIRC -0.48; TCGA KIRP -0.356; TCGA LUAD -0.22; TCGA LUSC -0.35; TCGA PAAD -0.199; TCGA PRAD -0.07; TCGA STAD -0.092; TCGA UCEC -0.148
hsa-miR-429
MAP1B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; OV; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.432; TCGA BRCA -0.276; TCGA CESC -0.259; TCGA COAD -0.581; TCGA ESCA -0.387; TCGA HNSC -0.279; TCGA KIRC -0.268; TCGA KIRP -0.538; TCGA LUAD -0.183; TCGA OV -0.158; TCGA PAAD -0.198; TCGA PRAD -0.138; TCGA THCA -0.055; TCGA STAD -0.475; TCGA UCEC -0.198
hsa-miR-429
MEF2D
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.122; TCGA CESC -0.157; TCGA COAD -0.115; TCGA ESCA -0.061; TCGA HNSC -0.162; TCGA KIRC -0.118; TCGA LUSC -0.17; TCGA STAD -0.115; TCGA UCEC -0.135
hsa-miR-429
MMP16
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.287; TCGA BRCA -0.265; TCGA CESC -0.259; TCGA COAD -0.574; TCGA ESCA -0.217; TCGA HNSC -0.515; TCGA KIRC -0.721; TCGA LUAD -0.142; TCGA LUSC -0.342; TCGA OV -0.218; TCGA PAAD -0.33; TCGA PRAD -0.164; TCGA STAD -0.326; TCGA UCEC -0.246
hsa-miR-429
DLC1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.143; TCGA BRCA -0.347; TCGA CESC -0.258; TCGA COAD -0.398; TCGA ESCA -0.173; TCGA HNSC -0.387; TCGA KIRC -0.069; TCGA LUAD -0.1; TCGA LUSC -0.592; TCGA PAAD -0.307; TCGA PRAD -0.124; TCGA STAD -0.256; TCGA UCEC -0.205
hsa-miR-429
PBX3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.15; TCGA CESC -0.146; TCGA COAD -0.349; TCGA ESCA -0.237; TCGA HNSC -0.107; TCGA KIRC -0.058; TCGA KIRP -0.093; TCGA LUAD -0.113; TCGA LUSC -0.191; TCGA PAAD -0.103; TCGA STAD -0.321; TCGA UCEC -0.356
hsa-miR-429
CRTAP
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.176; TCGA BRCA -0.21; TCGA CESC -0.175; TCGA COAD -0.102; TCGA ESCA -0.156; TCGA HNSC -0.156; TCGA KIRC -0.093; TCGA KIRP -0.259; TCGA LIHC -0.077; TCGA LUAD -0.167; TCGA LUSC -0.175; TCGA PAAD -0.175; TCGA PRAD -0.068; TCGA STAD -0.21; TCGA UCEC -0.18
hsa-miR-429
SLC16A2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.328; TCGA BRCA -0.22; TCGA CESC -0.488; TCGA COAD -0.51; TCGA ESCA -0.131; TCGA HNSC -0.32; TCGA LIHC -0.166; TCGA LUAD -0.177; TCGA LUSC -0.325; TCGA PAAD -0.215; TCGA PRAD -0.051; TCGA STAD -0.197; TCGA UCEC -0.32
hsa-miR-429
PLK2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PRAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.184; TCGA CESC -0.359; TCGA COAD -0.195; TCGA ESCA -0.114; TCGA HNSC -0.275; TCGA KIRC -0.437; TCGA KIRP -0.182; TCGA LUSC -0.175; TCGA OV -0.162; TCGA PRAD -0.073; TCGA UCEC -0.136
hsa-miR-429
SNTB2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.194; TCGA CESC -0.101; TCGA COAD -0.074; TCGA ESCA -0.127; TCGA HNSC -0.078; TCGA LUAD -0.081; TCGA PAAD -0.136; TCGA STAD -0.1; TCGA UCEC -0.159
hsa-miR-429
QKI
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.228; TCGA CESC -0.206; TCGA COAD -0.46; TCGA ESCA -0.303; TCGA HNSC -0.228; TCGA KIRC -0.101; TCGA KIRP -0.142; TCGA LUAD -0.201; TCGA LUSC -0.206; TCGA OV -0.053; TCGA PAAD -0.29; TCGA PRAD -0.07; TCGA STAD -0.262; TCGA UCEC -0.196
hsa-miR-429
MLLT11
11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.081; TCGA COAD -0.441; TCGA ESCA -0.265; TCGA HNSC -0.155; TCGA KIRP -0.275; TCGA LIHC -0.077; TCGA OV -0.138; TCGA PAAD -0.177; TCGA PRAD -0.052; TCGA STAD -0.353; TCGA UCEC -0.192
hsa-miR-429
PTPN21
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.1; TCGA BRCA -0.243; TCGA COAD -0.102; TCGA ESCA -0.084; TCGA HNSC -0.219; TCGA LUAD -0.159; TCGA LUSC -0.372; TCGA PRAD -0.091; TCGA STAD -0.149; TCGA UCEC -0.186
hsa-miR-429
TRIO
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.087; TCGA BRCA -0.095; TCGA ESCA -0.137; TCGA HNSC -0.164; TCGA KIRC -0.162; TCGA KIRP -0.12; TCGA LUAD -0.059; TCGA PAAD -0.121; TCGA PRAD -0.068; TCGA THCA -0.051; TCGA STAD -0.134; TCGA UCEC -0.08
hsa-miR-429
KLF12
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.273; TCGA BRCA -0.125; TCGA COAD -0.321; TCGA ESCA -0.237; TCGA HNSC -0.138; TCGA LIHC -0.083; TCGA LUAD -0.112; TCGA LUSC -0.22; TCGA OV -0.115; TCGA PAAD -0.255; TCGA PRAD -0.135; TCGA STAD -0.245; TCGA UCEC -0.188
hsa-miR-429
DNAJB5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.425; TCGA BRCA -0.117; TCGA CESC -0.305; TCGA COAD -0.62; TCGA ESCA -0.471; TCGA HNSC -0.288; TCGA KIRC -0.068; TCGA KIRP -0.092; TCGA LUAD -0.109; TCGA LUSC -0.118; TCGA PAAD -0.265; TCGA PRAD -0.111; TCGA STAD -0.553; TCGA UCEC -0.215
hsa-miR-429
MMD
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.38; TCGA COAD -0.091; TCGA ESCA -0.148; TCGA HNSC -0.061; TCGA KIRC -0.081; TCGA KIRP -0.189; TCGA LUAD -0.181; TCGA LUSC -0.137; TCGA PAAD -0.237; TCGA PRAD -0.063; TCGA STAD -0.182; TCGA UCEC -0.082
hsa-miR-429
PPARGC1A
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUSC; OV; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.431; TCGA BRCA -0.348; TCGA CESC -0.269; TCGA HNSC -0.344; TCGA KIRP -0.239; TCGA LUSC -0.198; TCGA OV -0.452; TCGA THCA -0.148; TCGA STAD -0.134; TCGA UCEC -0.303
hsa-miR-429
USP25
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.072; TCGA BRCA -0.082; TCGA CESC -0.085; TCGA ESCA -0.104; TCGA HNSC -0.155; TCGA LUAD -0.101; TCGA LUSC -0.181; TCGA PAAD -0.082; TCGA PRAD -0.065; TCGA STAD -0.1; TCGA UCEC -0.091
hsa-miR-429
ADAMTS3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.345; TCGA BRCA -0.305; TCGA CESC -0.42; TCGA COAD -0.512; TCGA ESCA -0.243; TCGA HNSC -0.286; TCGA LUAD -0.193; TCGA LUSC -0.231; TCGA OV -0.275; TCGA PAAD -0.502; TCGA THCA -0.064; TCGA STAD -0.162; TCGA UCEC -0.292
hsa-miR-429
LATS2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.223; TCGA BRCA -0.21; TCGA CESC -0.213; TCGA COAD -0.328; TCGA ESCA -0.14; TCGA HNSC -0.294; TCGA KIRP -0.067; TCGA LUAD -0.213; TCGA LUSC -0.355; TCGA PAAD -0.209; TCGA PRAD -0.076; TCGA STAD -0.181; TCGA UCEC -0.212
hsa-miR-429
SCHIP1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.199; TCGA BRCA -0.122; TCGA COAD -0.476; TCGA ESCA -0.288; TCGA HNSC -0.089; TCGA LIHC -0.075; TCGA LUAD -0.174; TCGA PAAD -0.201; TCGA PRAD -0.085; TCGA UCEC -0.202
hsa-miR-429
SH3PXD2A
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.102; TCGA BRCA -0.094; TCGA CESC -0.081; TCGA COAD -0.118; TCGA ESCA -0.092; TCGA HNSC -0.121; TCGA KIRC -0.282; TCGA PAAD -0.146; TCGA STAD -0.136; TCGA UCEC -0.176
hsa-miR-429
RIMS3
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.202; TCGA BRCA -0.139; TCGA CESC -0.324; TCGA ESCA -0.23; TCGA HNSC -0.27; TCGA LUSC -0.249; TCGA PAAD -0.105; TCGA PRAD -0.086; TCGA STAD -0.331; TCGA UCEC -0.349
hsa-miR-429
ARHGEF17
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.184; TCGA BRCA -0.069; TCGA CESC -0.109; TCGA COAD -0.413; TCGA ESCA -0.216; TCGA HNSC -0.155; TCGA KIRC -0.104; TCGA LUSC -0.246; TCGA PAAD -0.143; TCGA STAD -0.279; TCGA UCEC -0.132
hsa-miR-429
RUSC2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.267; TCGA BRCA -0.108; TCGA CESC -0.205; TCGA COAD -0.236; TCGA ESCA -0.13; TCGA HNSC -0.317; TCGA KIRP -0.103; TCGA LUAD -0.154; TCGA LUSC -0.302; TCGA PRAD -0.079; TCGA STAD -0.236; TCGA UCEC -0.234
hsa-miR-429
NAV3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.51; TCGA BRCA -0.358; TCGA CESC -0.324; TCGA COAD -0.781; TCGA ESCA -0.539; TCGA HNSC -0.496; TCGA KIRC -0.217; TCGA LIHC -0.098; TCGA LUAD -0.349; TCGA LUSC -0.465; TCGA PAAD -0.43; TCGA PRAD -0.072; TCGA STAD -0.424; TCGA UCEC -0.379
hsa-miR-429
NFASC
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.234; TCGA BRCA -0.106; TCGA CESC -0.359; TCGA COAD -0.354; TCGA ESCA -0.55; TCGA HNSC -0.133; TCGA LUSC -0.314; TCGA PAAD -0.159; TCGA PRAD -0.099; TCGA STAD -0.565; TCGA UCEC -0.318
hsa-miR-429
THSD7A
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.176; TCGA BRCA -0.383; TCGA COAD -0.806; TCGA ESCA -0.187; TCGA HNSC -0.421; TCGA LUAD -0.192; TCGA LUSC -0.509; TCGA PAAD -0.314; TCGA STAD -0.27; TCGA UCEC -0.087
hsa-miR-429
SLC39A14
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.277; TCGA BRCA -0.091; TCGA CESC -0.103; TCGA HNSC -0.216; TCGA KIRC -0.416; TCGA KIRP -0.379; TCGA LIHC -0.061; TCGA LUAD -0.123; TCGA LUSC -0.068; TCGA PRAD -0.096; TCGA THCA -0.07; TCGA UCEC -0.104
hsa-miR-429
SEMA6D
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; OV; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.192; TCGA BRCA -0.388; TCGA CESC -0.21; TCGA ESCA -0.234; TCGA HNSC -0.202; TCGA LUAD -0.109; TCGA OV -0.167; TCGA PAAD -0.167; TCGA STAD -0.188; TCGA UCEC -0.205
hsa-miR-429
PLXNA4
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
PITA; miRNATAP
TCGA BLCA -0.49; TCGA BRCA -0.528; TCGA COAD -0.888; TCGA ESCA -0.427; TCGA HNSC -0.452; TCGA LUAD -0.171; TCGA LUSC -0.495; TCGA PAAD -0.485; TCGA STAD -0.424
hsa-miR-429
ZDBF2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.25; TCGA BRCA -0.313; TCGA CESC -0.378; TCGA COAD -0.48; TCGA ESCA -0.34; TCGA HNSC -0.222; TCGA LUAD -0.154; TCGA LUSC -0.115; TCGA PAAD -0.173; TCGA STAD -0.337; TCGA UCEC -0.477
hsa-miR-429
RECK
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.33; TCGA BRCA -0.377; TCGA CESC -0.459; TCGA COAD -0.441; TCGA ESCA -0.33; TCGA HNSC -0.461; TCGA KIRC -0.058; TCGA KIRP -0.129; TCGA LUAD -0.275; TCGA LUSC -0.535; TCGA PAAD -0.355; TCGA PRAD -0.114; TCGA STAD -0.352; TCGA UCEC -0.395
hsa-miR-429
BACH2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.436; TCGA BRCA -0.272; TCGA CESC -0.175; TCGA COAD -0.622; TCGA ESCA -0.355; TCGA HNSC -0.239; TCGA KIRP -0.335; TCGA LUAD -0.14; TCGA OV -0.315; TCGA PAAD -0.434; TCGA STAD -0.255; TCGA UCEC -0.326
hsa-miR-429
TEAD1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.223; TCGA CESC -0.069; TCGA COAD -0.124; TCGA ESCA -0.085; TCGA HNSC -0.199; TCGA LUAD -0.09; TCGA LUSC -0.107; TCGA PAAD -0.077; TCGA PRAD -0.079; TCGA STAD -0.296; TCGA UCEC -0.152
hsa-miR-429
NAP1L2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; OV; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.152; TCGA BRCA -0.376; TCGA CESC -0.375; TCGA COAD -0.808; TCGA ESCA -0.591; TCGA KIRP -0.234; TCGA LIHC -0.197; TCGA LUAD -0.155; TCGA OV -0.2; TCGA PAAD -0.213; TCGA STAD -0.61; TCGA UCEC -0.34
hsa-miR-429
ST6GALNAC5
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
PITA; miRanda
TCGA BLCA -0.316; TCGA CESC -0.203; TCGA COAD -0.839; TCGA ESCA -0.273; TCGA HNSC -0.131; TCGA LUAD -0.263; TCGA LUSC -0.349; TCGA PAAD -0.215; TCGA STAD -0.375
hsa-miR-429
KBTBD8
9 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.077; TCGA HNSC -0.155; TCGA KIRC -0.141; TCGA LIHC -0.056; TCGA LUAD -0.142; TCGA LUSC -0.31; TCGA PAAD -0.406; TCGA PRAD -0.066
hsa-miR-429
GLIS2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.262; TCGA CESC -0.159; TCGA COAD -0.488; TCGA ESCA -0.208; TCGA HNSC -0.157; TCGA KIRP -0.119; TCGA LUSC -0.274; TCGA OV -0.116; TCGA PAAD -0.132; TCGA STAD -0.2; TCGA UCEC -0.188
hsa-miR-429
STARD13
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.298; TCGA BRCA -0.186; TCGA CESC -0.227; TCGA COAD -0.163; TCGA ESCA -0.121; TCGA HNSC -0.381; TCGA KIRC -0.107; TCGA KIRP -0.089; TCGA LIHC -0.06; TCGA LUAD -0.221; TCGA LUSC -0.468; TCGA PAAD -0.169; TCGA PRAD -0.066; TCGA STAD -0.217; TCGA UCEC -0.176
hsa-miR-429
MYLK
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.494; TCGA BRCA -0.336; TCGA CESC -0.493; TCGA COAD -0.767; TCGA ESCA -0.559; TCGA HNSC -0.199; TCGA KIRP -0.297; TCGA LIHC -0.099; TCGA LUAD -0.231; TCGA LUSC -0.306; TCGA OV -0.105; TCGA PAAD -0.367; TCGA PRAD -0.156; TCGA STAD -0.686; TCGA UCEC -0.507
hsa-miR-429
ANKH
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.258; TCGA BRCA -0.103; TCGA CESC -0.241; TCGA ESCA -0.074; TCGA HNSC -0.155; TCGA KIRC -0.109; TCGA KIRP -0.122; TCGA PAAD -0.075; TCGA STAD -0.061; TCGA UCEC -0.066
hsa-miR-429
BMPER
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.303; TCGA BRCA -0.571; TCGA CESC -0.681; TCGA ESCA -0.458; TCGA HNSC -0.309; TCGA KIRC -0.209; TCGA LUAD -0.207; TCGA LUSC -0.263; TCGA PAAD -0.467; TCGA PRAD -0.256; TCGA STAD -0.552; TCGA UCEC -0.561
hsa-miR-429
MAMDC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.562; TCGA BRCA -0.58; TCGA CESC -0.769; TCGA COAD -1.202; TCGA ESCA -0.619; TCGA HNSC -0.548; TCGA LUSC -0.661; TCGA PAAD -0.393; TCGA PRAD -0.144; TCGA STAD -0.72; TCGA UCEC -0.705
hsa-miR-429
CSF1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.413; TCGA BRCA -0.191; TCGA CESC -0.268; TCGA COAD -0.356; TCGA ESCA -0.201; TCGA HNSC -0.412; TCGA KIRC -0.223; TCGA KIRP -0.318; TCGA LUAD -0.185; TCGA LUSC -0.38; TCGA PAAD -0.271; TCGA PRAD -0.073; TCGA STAD -0.13; TCGA UCEC -0.095
hsa-miR-429
NEGR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.498; TCGA BRCA -0.374; TCGA CESC -0.397; TCGA COAD -0.672; TCGA ESCA -0.358; TCGA HNSC -0.487; TCGA LUAD -0.109; TCGA LUSC -0.485; TCGA OV -0.382; TCGA PAAD -0.185; TCGA PRAD -0.181; TCGA STAD -0.549; TCGA UCEC -0.472
hsa-miR-429
CNTN4
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; OV; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.115; TCGA BRCA -0.326; TCGA CESC -0.213; TCGA COAD -0.668; TCGA HNSC -0.405; TCGA LUSC -0.393; TCGA OV -0.231; TCGA PAAD -0.194; TCGA STAD -0.255; TCGA UCEC -0.35
hsa-miR-429
RAB37
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LIHC; LUSC; PAAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.269; TCGA CESC -0.111; TCGA COAD -0.14; TCGA KIRC -0.386; TCGA KIRP -0.16; TCGA LIHC -0.068; TCGA LUSC -0.361; TCGA PAAD -0.217; TCGA UCEC -0.101
hsa-miR-429
IL6ST
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.294; TCGA BRCA -0.327; TCGA CESC -0.175; TCGA COAD -0.36; TCGA ESCA -0.175; TCGA HNSC -0.46; TCGA KIRP -0.291; TCGA LUAD -0.184; TCGA LUSC -0.453; TCGA PAAD -0.276; TCGA PRAD -0.203; TCGA STAD -0.216; TCGA UCEC -0.229
hsa-miR-429
TMEM26
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; UCEC
PITA; miRanda
TCGA BLCA -0.164; TCGA CESC -0.322; TCGA COAD -0.287; TCGA HNSC -0.328; TCGA KIRC -0.157; TCGA KIRP -0.182; TCGA LUAD -0.203; TCGA LUSC -0.247; TCGA OV -0.139; TCGA PAAD -0.299; TCGA UCEC -0.1
hsa-miR-429
HECTD2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.124; TCGA BRCA -0.072; TCGA CESC -0.12; TCGA COAD -0.388; TCGA ESCA -0.188; TCGA HNSC -0.113; TCGA KIRC -0.073; TCGA LUAD -0.092; TCGA LUSC -0.113; TCGA PAAD -0.196; TCGA PRAD -0.082; TCGA STAD -0.287; TCGA UCEC -0.192
hsa-miR-429
ADAMTS9
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.209; TCGA BRCA -0.27; TCGA CESC -0.208; TCGA COAD -0.237; TCGA HNSC -0.314; TCGA LUAD -0.184; TCGA LUSC -0.322; TCGA OV -0.14; TCGA PAAD -0.248; TCGA STAD -0.119; TCGA UCEC -0.08
hsa-miR-429
NIN
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.092; TCGA BRCA -0.053; TCGA CESC -0.072; TCGA COAD -0.167; TCGA ESCA -0.218; TCGA KIRC -0.113; TCGA LUAD -0.098; TCGA LUSC -0.078; TCGA PAAD -0.264; TCGA STAD -0.194; TCGA UCEC -0.054
hsa-miR-429
LYSMD3
9 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.069; TCGA HNSC -0.137; TCGA KIRP -0.093; TCGA LIHC -0.073; TCGA LUAD -0.053; TCGA LUSC -0.204; TCGA PAAD -0.087; TCGA UCEC -0.092
hsa-miR-429
SERPINE2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.461; TCGA CESC -0.208; TCGA COAD -0.173; TCGA ESCA -0.414; TCGA HNSC -0.268; TCGA KIRC -0.221; TCGA KIRP -0.361; TCGA LUAD -0.146; TCGA PAAD -0.272; TCGA PRAD -0.123; TCGA STAD -0.255
hsa-miR-429
COL6A6
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.288; TCGA BRCA -0.566; TCGA CESC -0.359; TCGA ESCA -0.231; TCGA HNSC -0.198; TCGA LUAD -0.28; TCGA LUSC -0.531; TCGA PAAD -0.449; TCGA STAD -0.152; TCGA UCEC -0.443
hsa-miR-429
ITGB1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.11; TCGA BRCA -0.133; TCGA CESC -0.168; TCGA COAD -0.157; TCGA ESCA -0.081; TCGA HNSC -0.172; TCGA KIRC -0.159; TCGA LUAD -0.142; TCGA LUSC -0.156; TCGA PAAD -0.077; TCGA STAD -0.18; TCGA UCEC -0.071
hsa-miR-429
LCP1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.217; TCGA CESC -0.259; TCGA COAD -0.407; TCGA ESCA -0.214; TCGA HNSC -0.268; TCGA KIRC -0.394; TCGA KIRP -0.186; TCGA LUAD -0.273; TCGA LUSC -0.455; TCGA PAAD -0.476
hsa-miR-429
LRRC17
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.272; TCGA BRCA -0.294; TCGA COAD -0.459; TCGA ESCA -0.446; TCGA HNSC -0.473; TCGA KIRC -0.312; TCGA PAAD -0.295; TCGA PRAD -0.099; TCGA STAD -0.277; TCGA UCEC -0.096
hsa-miR-429
WT1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.521; TCGA CESC -0.359; TCGA COAD -0.626; TCGA ESCA -0.464; TCGA HNSC -0.311; TCGA LUAD -0.529; TCGA LUSC -0.309; TCGA PAAD -0.798; TCGA UCEC -0.599
hsa-miR-429
SPG20
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.162; TCGA CESC -0.236; TCGA COAD -0.58; TCGA ESCA -0.42; TCGA HNSC -0.108; TCGA KIRP -0.119; TCGA LUAD -0.137; TCGA LUSC -0.151; TCGA PAAD -0.284; TCGA PRAD -0.124; TCGA STAD -0.34; TCGA UCEC -0.186
hsa-miR-429
GSN
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.247; TCGA BRCA -0.326; TCGA COAD -0.214; TCGA ESCA -0.2; TCGA HNSC -0.056; TCGA KIRC -0.125; TCGA LUSC -0.144; TCGA PRAD -0.098; TCGA STAD -0.282; TCGA UCEC -0.183
hsa-miR-429
VCAN
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.295; TCGA BRCA -0.069; TCGA CESC -0.296; TCGA COAD -0.604; TCGA ESCA -0.229; TCGA HNSC -0.525; TCGA KIRC -0.473; TCGA LUAD -0.171; TCGA LUSC -0.203; TCGA PAAD -0.303; TCGA PRAD -0.117; TCGA STAD -0.093
hsa-miR-429
ARHGEF10
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.201; TCGA BRCA -0.152; TCGA CESC -0.162; TCGA COAD -0.11; TCGA ESCA -0.135; TCGA HNSC -0.163; TCGA KIRC -0.221; TCGA LUAD -0.121; TCGA LUSC -0.29; TCGA PAAD -0.075; TCGA STAD -0.181; TCGA UCEC -0.212
hsa-miR-429
NTM
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.167; TCGA BRCA -0.116; TCGA CESC -0.155; TCGA COAD -0.768; TCGA ESCA -0.271; TCGA HNSC -0.245; TCGA KIRC -0.389; TCGA LUAD -0.189; TCGA LUSC -0.339; TCGA PRAD -0.119; TCGA STAD -0.26
hsa-miR-429
CTNNAL1
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.155; TCGA BRCA -0.2; TCGA ESCA -0.084; TCGA HNSC -0.092; TCGA LUAD -0.117; TCGA LUSC -0.225; TCGA OV -0.07; TCGA STAD -0.162; TCGA UCEC -0.134
hsa-miR-429
ITGB2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.412; TCGA CESC -0.273; TCGA COAD -0.525; TCGA ESCA -0.24; TCGA HNSC -0.296; TCGA KIRC -0.458; TCGA KIRP -0.326; TCGA LUAD -0.22; TCGA LUSC -0.538; TCGA PAAD -0.378
hsa-miR-429
ANK2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.541; TCGA BRCA -0.457; TCGA CESC -0.318; TCGA COAD -0.904; TCGA ESCA -0.535; TCGA HNSC -0.53; TCGA KIRP -0.592; TCGA LUAD -0.173; TCGA LUSC -0.583; TCGA PAAD -0.475; TCGA PRAD -0.083; TCGA THCA -0.083; TCGA STAD -0.566; TCGA UCEC -0.262
hsa-miR-429
CTSB
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.22; TCGA CESC -0.115; TCGA COAD -0.196; TCGA HNSC -0.114; TCGA KIRC -0.115; TCGA KIRP -0.223; TCGA LUAD -0.199; TCGA LUSC -0.141; TCGA PAAD -0.147
hsa-miR-429
RABGAP1L
9 cancers: BLCA; BRCA; CESC; KIRP; LUSC; PAAD; PRAD; THCA; UCEC
miRanda; miRNATAP
TCGA BLCA -0.068; TCGA BRCA -0.071; TCGA CESC -0.062; TCGA KIRP -0.173; TCGA LUSC -0.158; TCGA PAAD -0.082; TCGA PRAD -0.062; TCGA THCA -0.05; TCGA UCEC -0.089
hsa-miR-429
SIK3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.108; TCGA BRCA -0.068; TCGA CESC -0.085; TCGA COAD -0.086; TCGA ESCA -0.088; TCGA HNSC -0.13; TCGA LUAD -0.059; TCGA LUSC -0.072; TCGA PAAD -0.077; TCGA STAD -0.117
hsa-miR-429
FAM114A2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.057; TCGA CESC -0.076; TCGA COAD -0.061; TCGA ESCA -0.069; TCGA HNSC -0.149; TCGA KIRC -0.055; TCGA KIRP -0.085; TCGA LIHC -0.067; TCGA LUAD -0.091; TCGA LUSC -0.175; TCGA PAAD -0.115; TCGA STAD -0.078; TCGA UCEC -0.096
hsa-miR-429
SLAMF7
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.164; TCGA CESC -0.387; TCGA COAD -0.445; TCGA HNSC -0.202; TCGA KIRC -0.535; TCGA KIRP -0.216; TCGA LUAD -0.177; TCGA LUSC -0.432; TCGA PAAD -0.483
hsa-miR-429
PTPN12
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD
miRanda
TCGA BLCA -0.099; TCGA CESC -0.086; TCGA COAD -0.07; TCGA ESCA -0.068; TCGA HNSC -0.093; TCGA KIRC -0.23; TCGA LUAD -0.106; TCGA LUSC -0.087; TCGA STAD -0.067
hsa-miR-429
HLA-DMB
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.314; TCGA BRCA -0.056; TCGA COAD -0.409; TCGA HNSC -0.227; TCGA KIRC -0.196; TCGA KIRP -0.164; TCGA LUAD -0.16; TCGA LUSC -0.544; TCGA PAAD -0.437
hsa-miR-429
ITGA9
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.271; TCGA BRCA -0.312; TCGA CESC -0.248; TCGA COAD -0.393; TCGA ESCA -0.298; TCGA HNSC -0.409; TCGA LUSC -0.486; TCGA PAAD -0.408; TCGA PRAD -0.197; TCGA STAD -0.393; TCGA UCEC -0.192
hsa-miR-429
ARHGAP15
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.278; TCGA BRCA -0.102; TCGA CESC -0.396; TCGA COAD -0.501; TCGA ESCA -0.271; TCGA HNSC -0.235; TCGA KIRC -0.368; TCGA LUAD -0.196; TCGA LUSC -0.532; TCGA PAAD -0.514; TCGA STAD -0.187; TCGA UCEC -0.091
hsa-miR-429
SHC4
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.186; TCGA CESC -0.199; TCGA COAD -0.583; TCGA ESCA -0.281; TCGA HNSC -0.196; TCGA LIHC -0.1; TCGA PAAD -0.205; TCGA STAD -0.349; TCGA UCEC -0.075
hsa-miR-429
FBLN5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.303; TCGA BRCA -0.333; TCGA CESC -0.283; TCGA COAD -0.618; TCGA ESCA -0.261; TCGA HNSC -0.4; TCGA LUAD -0.119; TCGA LUSC -0.404; TCGA PAAD -0.397; TCGA PRAD -0.085; TCGA STAD -0.316; TCGA UCEC -0.288
hsa-miR-429
WWC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.173; TCGA BRCA -0.195; TCGA CESC -0.2; TCGA COAD -0.396; TCGA ESCA -0.127; TCGA HNSC -0.252; TCGA LUAD -0.183; TCGA LUSC -0.483; TCGA PAAD -0.152; TCGA STAD -0.148; TCGA UCEC -0.11
hsa-miR-429
CD86
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.352; TCGA CESC -0.302; TCGA COAD -0.545; TCGA ESCA -0.264; TCGA HNSC -0.272; TCGA KIRC -0.459; TCGA KIRP -0.329; TCGA LUAD -0.282; TCGA LUSC -0.417; TCGA PAAD -0.43; TCGA PRAD -0.062
hsa-miR-429
MME
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.149; TCGA BRCA -0.617; TCGA CESC -0.387; TCGA HNSC -0.52; TCGA KIRP -0.321; TCGA LIHC -0.46; TCGA LUAD -0.378; TCGA LUSC -0.404; TCGA PAAD -0.254; TCGA UCEC -0.193
hsa-miR-429
TACC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.06; TCGA BRCA -0.369; TCGA CESC -0.125; TCGA COAD -0.12; TCGA ESCA -0.13; TCGA HNSC -0.109; TCGA LUAD -0.177; TCGA LUSC -0.148; TCGA PAAD -0.159; TCGA PRAD -0.077; TCGA STAD -0.305; TCGA UCEC -0.347
hsa-miR-429
CALD1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.425; TCGA BRCA -0.194; TCGA CESC -0.44; TCGA COAD -0.679; TCGA ESCA -0.464; TCGA HNSC -0.38; TCGA KIRC -0.194; TCGA KIRP -0.12; TCGA LIHC -0.064; TCGA LUAD -0.236; TCGA LUSC -0.32; TCGA OV -0.098; TCGA PAAD -0.329; TCGA PRAD -0.099; TCGA STAD -0.513; TCGA UCEC -0.37
hsa-miR-429
NAP1L1
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.069; TCGA CESC -0.055; TCGA ESCA -0.087; TCGA KIRC -0.158; TCGA KIRP -0.15; TCGA OV -0.089; TCGA PAAD -0.098; TCGA STAD -0.126; TCGA UCEC -0.115
hsa-miR-429
HEG1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.306; TCGA BRCA -0.258; TCGA CESC -0.377; TCGA COAD -0.5; TCGA ESCA -0.273; TCGA HNSC -0.31; TCGA KIRC -0.085; TCGA KIRP -0.157; TCGA LUAD -0.294; TCGA LUSC -0.426; TCGA PAAD -0.31; TCGA PRAD -0.079; TCGA STAD -0.239; TCGA UCEC -0.252
hsa-miR-429
SLMAP
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.054; TCGA CESC -0.074; TCGA COAD -0.107; TCGA ESCA -0.102; TCGA HNSC -0.101; TCGA LUAD -0.054; TCGA LUSC -0.063; TCGA PRAD -0.096; TCGA STAD -0.262; TCGA UCEC -0.188
hsa-miR-429
PDGFRA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.284; TCGA BRCA -0.374; TCGA CESC -0.246; TCGA COAD -0.427; TCGA ESCA -0.131; TCGA HNSC -0.365; TCGA LUAD -0.246; TCGA LUSC -0.368; TCGA PAAD -0.488; TCGA PRAD -0.123; TCGA STAD -0.104; TCGA UCEC -0.329
hsa-miR-429
GPX8
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.313; TCGA BRCA -0.07; TCGA CESC -0.162; TCGA COAD -0.445; TCGA ESCA -0.207; TCGA HNSC -0.242; TCGA KIRC -0.231; TCGA KIRP -0.256; TCGA LUAD -0.205; TCGA LUSC -0.084; TCGA OV -0.097; TCGA PAAD -0.172; TCGA PRAD -0.088; TCGA STAD -0.136; TCGA UCEC -0.158
hsa-miR-429
IL6
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.672; TCGA BRCA -0.424; TCGA CESC -0.498; TCGA COAD -0.461; TCGA ESCA -0.444; TCGA HNSC -0.394; TCGA KIRC -0.182; TCGA LUAD -0.43; TCGA LUSC -0.538; TCGA PAAD -0.636; TCGA PRAD -0.187; TCGA STAD -0.24; TCGA UCEC -0.116
hsa-miR-429
FMNL2
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD
miRanda
TCGA BLCA -0.212; TCGA BRCA -0.195; TCGA CESC -0.087; TCGA ESCA -0.094; TCGA HNSC -0.103; TCGA KIRC -0.103; TCGA KIRP -0.234; TCGA LUSC -0.093; TCGA PAAD -0.094
hsa-miR-429
SHE
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.245; TCGA BRCA -0.409; TCGA CESC -0.22; TCGA COAD -0.536; TCGA ESCA -0.194; TCGA HNSC -0.3; TCGA LIHC -0.069; TCGA LUSC -0.547; TCGA OV -0.103; TCGA PAAD -0.365; TCGA PRAD -0.084; TCGA STAD -0.264; TCGA UCEC -0.387
hsa-miR-429
FAT4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.295; TCGA BRCA -0.456; TCGA CESC -0.258; TCGA COAD -0.471; TCGA ESCA -0.193; TCGA HNSC -0.445; TCGA LUAD -0.205; TCGA LUSC -0.427; TCGA PAAD -0.383; TCGA PRAD -0.164; TCGA STAD -0.278; TCGA UCEC -0.305
hsa-miR-429
DMD
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.395; TCGA BRCA -0.494; TCGA CESC -0.402; TCGA COAD -0.403; TCGA ESCA -0.284; TCGA HNSC -0.323; TCGA KIRC -0.065; TCGA LIHC -0.105; TCGA OV -0.135; TCGA PAAD -0.152; TCGA PRAD -0.116; TCGA STAD -0.52; TCGA UCEC -0.324
hsa-miR-429
HLA-DPA1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.349; TCGA BRCA -0.072; TCGA CESC -0.248; TCGA COAD -0.47; TCGA ESCA -0.168; TCGA HNSC -0.317; TCGA KIRC -0.341; TCGA KIRP -0.291; TCGA LUAD -0.223; TCGA LUSC -0.571; TCGA PAAD -0.438; TCGA UCEC -0.1
hsa-miR-429
RAPGEF1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.107; TCGA CESC -0.101; TCGA COAD -0.066; TCGA ESCA -0.119; TCGA HNSC -0.167; TCGA KIRC -0.131; TCGA KIRP -0.09; TCGA LUAD -0.069; TCGA LUSC -0.162; TCGA PAAD -0.11; TCGA STAD -0.082; TCGA UCEC -0.085
hsa-miR-429
LCP2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.333; TCGA BRCA -0.051; TCGA CESC -0.316; TCGA COAD -0.368; TCGA ESCA -0.138; TCGA HNSC -0.319; TCGA KIRC -0.453; TCGA KIRP -0.244; TCGA LUAD -0.276; TCGA LUSC -0.477; TCGA PAAD -0.418; TCGA PRAD -0.069
hsa-miR-429
PPM1K
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.217; TCGA BRCA -0.083; TCGA CESC -0.205; TCGA COAD -0.206; TCGA ESCA -0.133; TCGA HNSC -0.167; TCGA KIRP -0.132; TCGA LIHC -0.073; TCGA LUAD -0.071; TCGA LUSC -0.288; TCGA PAAD -0.276; TCGA PRAD -0.052; TCGA STAD -0.249; TCGA UCEC -0.241
hsa-miR-429
CACNA2D4
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.211; TCGA BRCA -0.116; TCGA CESC -0.177; TCGA HNSC -0.133; TCGA KIRC -0.359; TCGA LUAD -0.122; TCGA LUSC -0.25; TCGA PAAD -0.149; TCGA UCEC -0.106
hsa-miR-429
NTNG1
9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.484; TCGA ESCA -0.452; TCGA HNSC -0.348; TCGA LUAD -0.273; TCGA LUSC -0.57; TCGA OV -0.414; TCGA PAAD -0.541; TCGA STAD -0.6; TCGA UCEC -0.304
hsa-miR-429
DOK5
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.325; TCGA BRCA -0.169; TCGA CESC -0.186; TCGA COAD -0.781; TCGA ESCA -0.274; TCGA HNSC -0.47; TCGA KIRP -0.187; TCGA LUAD -0.16; TCGA LUSC -0.433; TCGA OV -0.291; TCGA PAAD -0.322; TCGA PRAD -0.142; TCGA THCA -0.107; TCGA STAD -0.225; TCGA UCEC -0.256
hsa-miR-429
COL4A3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.186; TCGA BRCA -0.182; TCGA CESC -0.28; TCGA COAD -0.389; TCGA ESCA -0.339; TCGA HNSC -0.281; TCGA LUSC -0.545; TCGA PAAD -0.519; TCGA STAD -0.338; TCGA UCEC -0.248
hsa-miR-429
ENPP2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.249; TCGA BRCA -0.488; TCGA CESC -0.356; TCGA COAD -0.566; TCGA ESCA -0.236; TCGA HNSC -0.383; TCGA KIRC -0.278; TCGA LUAD -0.222; TCGA LUSC -0.473; TCGA PAAD -0.224; TCGA PRAD -0.075; TCGA STAD -0.136; TCGA UCEC -0.374
hsa-miR-429
PPP2R3A
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.155; TCGA BRCA -0.053; TCGA CESC -0.211; TCGA COAD -0.145; TCGA ESCA -0.298; TCGA HNSC -0.188; TCGA PRAD -0.066; TCGA STAD -0.289; TCGA UCEC -0.1
hsa-miR-429
TXNDC15
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.087; TCGA CESC -0.051; TCGA COAD -0.112; TCGA ESCA -0.112; TCGA HNSC -0.084; TCGA KIRC -0.061; TCGA KIRP -0.07; TCGA LIHC -0.055; TCGA LUSC -0.169; TCGA STAD -0.107; TCGA UCEC -0.115
hsa-miR-429
IGDCC4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.262; TCGA BRCA -0.207; TCGA CESC -0.276; TCGA COAD -0.285; TCGA ESCA -0.188; TCGA HNSC -0.534; TCGA KIRP -0.222; TCGA LUAD -0.191; TCGA LUSC -0.265; TCGA PAAD -0.48; TCGA PRAD -0.158; TCGA STAD -0.128; TCGA UCEC -0.291
hsa-miR-429
ELMO1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.254; TCGA BRCA -0.177; TCGA CESC -0.314; TCGA COAD -0.385; TCGA ESCA -0.224; TCGA HNSC -0.225; TCGA KIRC -0.405; TCGA KIRP -0.179; TCGA LIHC -0.092; TCGA LUAD -0.154; TCGA LUSC -0.276; TCGA PAAD -0.226; TCGA STAD -0.158; TCGA UCEC -0.132
hsa-miR-429
ACTN1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.318; TCGA CESC -0.251; TCGA COAD -0.139; TCGA ESCA -0.229; TCGA HNSC -0.244; TCGA KIRC -0.226; TCGA LUAD -0.108; TCGA LUSC -0.15; TCGA PRAD -0.069; TCGA STAD -0.295; TCGA UCEC -0.134
hsa-miR-429
NGF
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.382; TCGA BRCA -0.122; TCGA CESC -0.37; TCGA ESCA -0.397; TCGA HNSC -0.479; TCGA KIRC -0.275; TCGA KIRP -0.164; TCGA OV -0.218; TCGA PAAD -0.298; TCGA PRAD -0.094; TCGA STAD -0.351; TCGA UCEC -0.333
hsa-miR-429
CRISPLD1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; OV; PAAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.228; TCGA BRCA -0.247; TCGA COAD -0.78; TCGA ESCA -0.317; TCGA KIRP -0.434; TCGA LUAD -0.142; TCGA OV -0.254; TCGA PAAD -0.32; TCGA STAD -0.365
hsa-miR-429
PTGS1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.667; TCGA BRCA -0.081; TCGA CESC -0.363; TCGA COAD -0.386; TCGA ESCA -0.261; TCGA HNSC -0.194; TCGA LUAD -0.238; TCGA LUSC -0.378; TCGA PAAD -0.31; TCGA PRAD -0.157; TCGA STAD -0.254
hsa-miR-429
EBF1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.335; TCGA BRCA -0.523; TCGA CESC -0.354; TCGA COAD -0.491; TCGA ESCA -0.273; TCGA HNSC -0.407; TCGA KIRC -0.181; TCGA LIHC -0.083; TCGA LUAD -0.197; TCGA LUSC -0.405; TCGA PAAD -0.369; TCGA PRAD -0.124; TCGA STAD -0.315; TCGA UCEC -0.251
hsa-miR-429
KLHL5
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.317; TCGA BRCA -0.125; TCGA CESC -0.214; TCGA COAD -0.478; TCGA ESCA -0.264; TCGA KIRP -0.196; TCGA LUAD -0.191; TCGA PAAD -0.212; TCGA STAD -0.276; TCGA UCEC -0.161
hsa-miR-429
SNX10
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.135; TCGA CESC -0.342; TCGA COAD -0.194; TCGA ESCA -0.136; TCGA HNSC -0.167; TCGA KIRC -0.197; TCGA KIRP -0.28; TCGA LUAD -0.278; TCGA LUSC -0.308; TCGA PAAD -0.202; TCGA PRAD -0.055; TCGA UCEC -0.114
hsa-miR-429
DYSF
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.303; TCGA BRCA -0.108; TCGA CESC -0.419; TCGA COAD -0.343; TCGA ESCA -0.182; TCGA HNSC -0.508; TCGA KIRC -0.297; TCGA KIRP -0.485; TCGA LIHC -0.088; TCGA LUAD -0.234; TCGA LUSC -0.465; TCGA PAAD -0.303; TCGA PRAD -0.131; TCGA STAD -0.219; TCGA UCEC -0.113
hsa-miR-429
ZNF382
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.088; TCGA CESC -0.182; TCGA COAD -0.338; TCGA ESCA -0.289; TCGA HNSC -0.224; TCGA LUAD -0.074; TCGA LUSC -0.265; TCGA PAAD -0.216; TCGA STAD -0.358; TCGA UCEC -0.075
hsa-miR-429
HLA-DQB2
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD
miRanda
TCGA BLCA -0.204; TCGA CESC -0.218; TCGA COAD -0.436; TCGA ESCA -0.227; TCGA HNSC -0.262; TCGA KIRC -0.568; TCGA KIRP -0.208; TCGA LUSC -0.466; TCGA PAAD -0.323
hsa-miR-429
TMOD1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.211; TCGA COAD -0.342; TCGA ESCA -0.319; TCGA HNSC -0.309; TCGA LIHC -0.137; TCGA LUSC -0.201; TCGA STAD -0.323; TCGA UCEC -0.149
hsa-miR-429
PDE4B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.455; TCGA BRCA -0.082; TCGA CESC -0.224; TCGA COAD -0.267; TCGA ESCA -0.182; TCGA HNSC -0.403; TCGA KIRC -0.199; TCGA LUAD -0.211; TCGA LUSC -0.41; TCGA PAAD -0.366; TCGA PRAD -0.111; TCGA THCA -0.06; TCGA STAD -0.14; TCGA UCEC -0.126
hsa-miR-429
ABCC9
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.387; TCGA BRCA -0.464; TCGA CESC -0.389; TCGA COAD -0.773; TCGA ESCA -0.488; TCGA HNSC -0.556; TCGA KIRC -0.079; TCGA LIHC -0.255; TCGA LUAD -0.241; TCGA LUSC -0.378; TCGA OV -0.176; TCGA PAAD -0.407; TCGA PRAD -0.121; TCGA STAD -0.526; TCGA UCEC -0.38
hsa-miR-429
ZNF521
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.319; TCGA BRCA -0.238; TCGA CESC -0.319; TCGA COAD -0.62; TCGA ESCA -0.173; TCGA HNSC -0.421; TCGA KIRC -0.222; TCGA LUAD -0.185; TCGA LUSC -0.41; TCGA OV -0.33; TCGA PAAD -0.428; TCGA PRAD -0.101; TCGA STAD -0.247; TCGA UCEC -0.345
hsa-miR-429
TMEM136
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.151; TCGA CESC -0.099; TCGA COAD -0.265; TCGA ESCA -0.163; TCGA HNSC -0.1; TCGA KIRC -0.077; TCGA KIRP -0.239; TCGA LUAD -0.076; TCGA LUSC -0.073; TCGA STAD -0.226; TCGA UCEC -0.167
hsa-miR-429
CAP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.315; TCGA BRCA -0.085; TCGA CESC -0.235; TCGA COAD -0.546; TCGA ESCA -0.384; TCGA HNSC -0.494; TCGA KIRP -0.273; TCGA LIHC -0.189; TCGA LUAD -0.124; TCGA LUSC -0.282; TCGA PAAD -0.197; TCGA PRAD -0.105; TCGA STAD -0.572; TCGA UCEC -0.195
hsa-miR-429
F2R
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; UCEC
miRanda
TCGA BLCA -0.189; TCGA CESC -0.269; TCGA COAD -0.331; TCGA HNSC -0.305; TCGA KIRC -0.283; TCGA KIRP -0.215; TCGA LUAD -0.207; TCGA LUSC -0.316; TCGA OV -0.105; TCGA PAAD -0.262; TCGA UCEC -0.12
hsa-miR-429
CAPZA2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.109; TCGA BRCA -0.074; TCGA CESC -0.051; TCGA HNSC -0.12; TCGA KIRP -0.08; TCGA LUAD -0.105; TCGA LUSC -0.111; TCGA PRAD -0.055; TCGA STAD -0.062; TCGA UCEC -0.075
hsa-miR-429
FYN
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.275; TCGA BRCA -0.205; TCGA CESC -0.339; TCGA COAD -0.273; TCGA HNSC -0.289; TCGA KIRC -0.229; TCGA LUAD -0.111; TCGA LUSC -0.238; TCGA PAAD -0.249; TCGA STAD -0.137; TCGA UCEC -0.213
hsa-miR-429
MAP1LC3B
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.067; TCGA BRCA -0.083; TCGA CESC -0.115; TCGA ESCA -0.088; TCGA HNSC -0.132; TCGA KIRP -0.108; TCGA LUAD -0.071; TCGA LUSC -0.158; TCGA PAAD -0.052; TCGA PRAD -0.054; TCGA STAD -0.069; TCGA UCEC -0.07
hsa-miR-429
TMED7-TICAM2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA
miRanda
TCGA BLCA -0.128; TCGA BRCA -0.094; TCGA COAD -0.277; TCGA HNSC -0.186; TCGA KIRC -0.212; TCGA KIRP -0.323; TCGA LIHC -0.113; TCGA LUAD -0.239; TCGA LUSC -0.27; TCGA PAAD -0.24; TCGA THCA -0.101
hsa-miR-429
RPL23AP82
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; OV; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.103; TCGA CESC -0.063; TCGA COAD -0.078; TCGA ESCA -0.102; TCGA KIRC -0.059; TCGA LUAD -0.059; TCGA OV -0.088; TCGA PAAD -0.104; TCGA PRAD -0.052; TCGA STAD -0.077
hsa-miR-429
CDH2
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.327; TCGA COAD -0.938; TCGA ESCA -0.626; TCGA HNSC -0.456; TCGA KIRC -0.306; TCGA LUAD -0.158; TCGA LUSC -0.171; TCGA OV -0.234; TCGA PAAD -0.287; TCGA PRAD -0.186; TCGA STAD -0.324; TCGA UCEC -0.188
hsa-miR-429
RAP1A
10 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.119; TCGA CESC -0.059; TCGA ESCA -0.094; TCGA HNSC -0.121; TCGA LUAD -0.079; TCGA LUSC -0.128; TCGA PAAD -0.099; TCGA PRAD -0.055; TCGA STAD -0.157; TCGA UCEC -0.075
hsa-miR-429
RAB23
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.279; TCGA BRCA -0.054; TCGA CESC -0.094; TCGA COAD -0.292; TCGA ESCA -0.22; TCGA HNSC -0.157; TCGA KIRC -0.066; TCGA KIRP -0.141; TCGA LIHC -0.07; TCGA LUAD -0.18; TCGA PAAD -0.228; TCGA STAD -0.355; TCGA UCEC -0.238
hsa-miR-429
PKD2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.281; TCGA CESC -0.163; TCGA COAD -0.415; TCGA ESCA -0.189; TCGA HNSC -0.146; TCGA LUAD -0.083; TCGA LUSC -0.121; TCGA OV -0.098; TCGA PAAD -0.177; TCGA STAD -0.351; TCGA UCEC -0.255
hsa-miR-429
ARHGAP10
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.051; TCGA BRCA -0.271; TCGA CESC -0.219; TCGA COAD -0.504; TCGA ESCA -0.275; TCGA HNSC -0.108; TCGA KIRC -0.103; TCGA LUAD -0.172; TCGA LUSC -0.175; TCGA PAAD -0.134; TCGA PRAD -0.093; TCGA STAD -0.363; TCGA UCEC -0.143
hsa-miR-429
CTSK
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.303; TCGA BRCA -0.225; TCGA CESC -0.321; TCGA COAD -0.571; TCGA ESCA -0.267; TCGA HNSC -0.41; TCGA KIRC -0.153; TCGA KIRP -0.268; TCGA LUAD -0.154; TCGA LUSC -0.348; TCGA PAAD -0.357; TCGA PRAD -0.059; TCGA STAD -0.145; TCGA UCEC -0.299
hsa-miR-429
LRRC32
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.26; TCGA BRCA -0.236; TCGA CESC -0.276; TCGA COAD -0.408; TCGA ESCA -0.146; TCGA HNSC -0.389; TCGA LUAD -0.215; TCGA LUSC -0.504; TCGA PAAD -0.222; TCGA PRAD -0.098; TCGA STAD -0.162; TCGA UCEC -0.227
hsa-miR-429
PDLIM5
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.124; TCGA BRCA -0.054; TCGA CESC -0.108; TCGA HNSC -0.129; TCGA KIRP -0.063; TCGA LUAD -0.115; TCGA PRAD -0.123; TCGA STAD -0.066; TCGA UCEC -0.08
hsa-miR-429
ROBO1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.219; TCGA CESC -0.145; TCGA COAD -0.405; TCGA ESCA -0.18; TCGA HNSC -0.199; TCGA KIRC -0.167; TCGA LUAD -0.175; TCGA PAAD -0.342; TCGA STAD -0.226; TCGA UCEC -0.12
hsa-miR-429
GLS
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.122; TCGA BRCA -0.062; TCGA CESC -0.155; TCGA ESCA -0.088; TCGA HNSC -0.105; TCGA KIRP -0.265; TCGA LUAD -0.163; TCGA LUSC -0.219; TCGA PAAD -0.074; TCGA UCEC -0.194
hsa-miR-429
RBM43
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.054; TCGA BRCA -0.135; TCGA CESC -0.076; TCGA COAD -0.144; TCGA ESCA -0.13; TCGA HNSC -0.169; TCGA KIRC -0.091; TCGA LUAD -0.063; TCGA LUSC -0.148; TCGA PAAD -0.095; TCGA STAD -0.213; TCGA UCEC -0.161
hsa-miR-429
COL13A1
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.192; TCGA CESC -0.326; TCGA COAD -0.305; TCGA HNSC -0.109; TCGA KIRC -0.221; TCGA LUAD -0.116; TCGA LUSC -0.437; TCGA PAAD -0.32; TCGA PRAD -0.097; TCGA STAD -0.06
hsa-miR-429
LPP
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.174; TCGA COAD -0.175; TCGA ESCA -0.164; TCGA KIRP -0.116; TCGA PAAD -0.154; TCGA PRAD -0.142; TCGA THCA -0.056; TCGA STAD -0.374; TCGA UCEC -0.118
hsa-miR-429
CDK14
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.249; TCGA BRCA -0.136; TCGA COAD -0.667; TCGA ESCA -0.315; TCGA HNSC -0.239; TCGA LIHC -0.082; TCGA LUAD -0.172; TCGA LUSC -0.219; TCGA OV -0.182; TCGA PAAD -0.21; TCGA STAD -0.252; TCGA UCEC -0.152
hsa-miR-429
NEDD4
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.058; TCGA BRCA -0.17; TCGA CESC -0.288; TCGA COAD -0.102; TCGA ESCA -0.095; TCGA HNSC -0.275; TCGA KIRC -0.233; TCGA KIRP -0.232; TCGA LIHC -0.139; TCGA LUAD -0.27; TCGA LUSC -0.152; TCGA OV -0.108; TCGA PAAD -0.199; TCGA PRAD -0.133; TCGA STAD -0.205; TCGA UCEC -0.314
hsa-miR-429
SETBP1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.296; TCGA BRCA -0.197; TCGA CESC -0.294; TCGA COAD -0.525; TCGA ESCA -0.448; TCGA HNSC -0.239; TCGA PAAD -0.236; TCGA STAD -0.456; TCGA UCEC -0.281
hsa-miR-429
COL3A1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.368; TCGA BRCA -0.084; TCGA CESC -0.323; TCGA COAD -0.648; TCGA ESCA -0.238; TCGA HNSC -0.565; TCGA KIRC -0.458; TCGA LUAD -0.219; TCGA LUSC -0.244; TCGA PAAD -0.349; TCGA PRAD -0.12; TCGA STAD -0.102; TCGA UCEC -0.222
hsa-miR-429
LTBP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.169; TCGA BRCA -0.097; TCGA CESC -0.105; TCGA COAD -0.461; TCGA ESCA -0.368; TCGA HNSC -0.325; TCGA LUAD -0.156; TCGA PAAD -0.259; TCGA PRAD -0.079; TCGA STAD -0.336; TCGA UCEC -0.094
hsa-miR-429
MYCT1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.165; TCGA BRCA -0.367; TCGA CESC -0.296; TCGA COAD -0.42; TCGA ESCA -0.127; TCGA HNSC -0.335; TCGA KIRC -0.136; TCGA LUAD -0.219; TCGA LUSC -0.475; TCGA OV -0.076; TCGA PAAD -0.356; TCGA PRAD -0.114; TCGA STAD -0.2; TCGA UCEC -0.347
hsa-miR-429
PARK2
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.335; TCGA ESCA -0.201; TCGA HNSC -0.309; TCGA LIHC -0.106; TCGA PAAD -0.134; TCGA PRAD -0.077; TCGA STAD -0.381; TCGA UCEC -0.15
hsa-miR-429
ACSL4
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD
miRanda; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.263; TCGA CESC -0.145; TCGA COAD -0.14; TCGA HNSC -0.19; TCGA LUAD -0.242; TCGA LUSC -0.271; TCGA PAAD -0.106; TCGA PRAD -0.091
hsa-miR-429
FRMD6
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.123; TCGA BRCA -0.18; TCGA CESC -0.438; TCGA COAD -0.65; TCGA ESCA -0.467; TCGA HNSC -0.091; TCGA KIRC -0.175; TCGA LUAD -0.209; TCGA OV -0.101; TCGA PAAD -0.292; TCGA STAD -0.365; TCGA UCEC -0.373
hsa-miR-429
TGFBI
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD
miRanda
TCGA BLCA -0.416; TCGA BRCA -0.079; TCGA CESC -0.321; TCGA ESCA -0.276; TCGA HNSC -0.4; TCGA KIRC -0.702; TCGA KIRP -0.124; TCGA LUAD -0.339; TCGA LUSC -0.282; TCGA PRAD -0.058; TCGA STAD -0.183
hsa-miR-429
NOS3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.132; TCGA BRCA -0.131; TCGA CESC -0.183; TCGA COAD -0.151; TCGA HNSC -0.149; TCGA KIRC -0.083; TCGA LUSC -0.255; TCGA PAAD -0.219; TCGA PRAD -0.07; TCGA STAD -0.072; TCGA UCEC -0.084
hsa-miR-429
EIF5A2
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.294; TCGA BRCA -0.179; TCGA CESC -0.406; TCGA COAD -0.07; TCGA KIRC -0.082; TCGA KIRP -0.291; TCGA LUAD -0.117; TCGA PAAD -0.087; TCGA STAD -0.112; TCGA UCEC -0.226
hsa-miR-429
PPFIBP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.154; TCGA BRCA -0.151; TCGA CESC -0.132; TCGA COAD -0.159; TCGA ESCA -0.13; TCGA HNSC -0.187; TCGA LUAD -0.24; TCGA LUSC -0.146; TCGA PAAD -0.081; TCGA PRAD -0.063; TCGA STAD -0.122; TCGA UCEC -0.101
hsa-miR-429
IRF4
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; THCA; UCEC
miRanda
TCGA BLCA -0.333; TCGA BRCA -0.223; TCGA CESC -0.391; TCGA COAD -0.445; TCGA HNSC -0.158; TCGA KIRC -0.342; TCGA LUSC -0.372; TCGA PAAD -0.637; TCGA THCA -0.129; TCGA UCEC -0.142
hsa-miR-429
DKK3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.2; TCGA BRCA -0.231; TCGA CESC -0.33; TCGA COAD -0.425; TCGA ESCA -0.158; TCGA HNSC -0.236; TCGA KIRC -0.178; TCGA LUAD -0.147; TCGA LUSC -0.162; TCGA OV -0.131; TCGA PAAD -0.141; TCGA PRAD -0.075; TCGA STAD -0.22; TCGA UCEC -0.218
hsa-miR-429
BHLHE22
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.132; TCGA BRCA -0.25; TCGA CESC -0.331; TCGA COAD -0.569; TCGA ESCA -0.425; TCGA HNSC -0.226; TCGA KIRC -0.14; TCGA LUAD -0.11; TCGA LUSC -0.417; TCGA PAAD -0.464; TCGA STAD -0.351
hsa-miR-429
LAMA4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.31; TCGA BRCA -0.307; TCGA CESC -0.317; TCGA COAD -0.379; TCGA ESCA -0.215; TCGA HNSC -0.383; TCGA KIRC -0.643; TCGA LUAD -0.254; TCGA LUSC -0.401; TCGA PAAD -0.164; TCGA PRAD -0.108; TCGA STAD -0.272; TCGA UCEC -0.292
hsa-miR-429
OSBPL8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.07; TCGA BRCA -0.104; TCGA CESC -0.078; TCGA COAD -0.092; TCGA ESCA -0.08; TCGA HNSC -0.125; TCGA KIRP -0.136; TCGA LUAD -0.128; TCGA LUSC -0.053; TCGA OV -0.068; TCGA PAAD -0.19; TCGA STAD -0.076; TCGA UCEC -0.14
hsa-miR-429
TLL1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.476; TCGA BRCA -0.443; TCGA CESC -0.519; TCGA COAD -0.903; TCGA ESCA -0.513; TCGA HNSC -0.676; TCGA KIRC -0.208; TCGA LUAD -0.164; TCGA LUSC -0.402; TCGA OV -0.219; TCGA PAAD -0.394; TCGA PRAD -0.097; TCGA THCA -0.067; TCGA STAD -0.358; TCGA UCEC -0.351
hsa-miR-429
PI15
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.412; TCGA BRCA -0.22; TCGA CESC -0.489; TCGA COAD -0.722; TCGA ESCA -0.253; TCGA HNSC -0.245; TCGA LUAD -0.223; TCGA PAAD -0.324; TCGA PRAD -0.129; TCGA STAD -0.272; TCGA UCEC -0.512
hsa-miR-429
TMEM45A
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.344; TCGA CESC -0.481; TCGA COAD -0.524; TCGA ESCA -0.339; TCGA HNSC -0.231; TCGA KIRC -0.59; TCGA LUAD -0.128; TCGA PAAD -0.127; TCGA PRAD -0.057; TCGA STAD -0.119; TCGA UCEC -0.156
hsa-miR-429
MFAP5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.762; TCGA BRCA -0.362; TCGA CESC -0.565; TCGA COAD -1.099; TCGA ESCA -0.756; TCGA HNSC -0.575; TCGA KIRC -0.297; TCGA KIRP -0.461; TCGA LUAD -0.375; TCGA LUSC -0.6; TCGA PAAD -0.389; TCGA STAD -0.451; TCGA UCEC -0.35
hsa-miR-429
PLCL2
11 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.283; TCGA COAD -0.331; TCGA HNSC -0.32; TCGA LIHC -0.098; TCGA LUAD -0.153; TCGA LUSC -0.416; TCGA PAAD -0.141; TCGA PRAD -0.063; TCGA STAD -0.069; TCGA UCEC -0.179
hsa-miR-429
KANK2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.263; TCGA BRCA -0.244; TCGA CESC -0.144; TCGA COAD -0.428; TCGA ESCA -0.309; TCGA HNSC -0.255; TCGA KIRC -0.109; TCGA KIRP -0.076; TCGA LUAD -0.135; TCGA LUSC -0.391; TCGA OV -0.091; TCGA PAAD -0.206; TCGA PRAD -0.104; TCGA STAD -0.395; TCGA UCEC -0.331
hsa-miR-429
ARID5B
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.251; TCGA CESC -0.149; TCGA COAD -0.093; TCGA ESCA -0.165; TCGA HNSC -0.121; TCGA LUAD -0.07; TCGA PAAD -0.27; TCGA STAD -0.113; TCGA UCEC -0.13
hsa-miR-429
MBNL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.137; TCGA BRCA -0.159; TCGA CESC -0.1; TCGA COAD -0.073; TCGA ESCA -0.149; TCGA HNSC -0.084; TCGA KIRC -0.144; TCGA KIRP -0.096; TCGA LUAD -0.087; TCGA PAAD -0.195; TCGA PRAD -0.061; TCGA STAD -0.178; TCGA UCEC -0.144
hsa-miR-429
ANGPT1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.316; TCGA BRCA -0.493; TCGA CESC -0.279; TCGA COAD -0.544; TCGA ESCA -0.304; TCGA HNSC -0.28; TCGA LIHC -0.064; TCGA LUAD -0.251; TCGA LUSC -0.36; TCGA OV -0.24; TCGA PAAD -0.366; TCGA PRAD -0.115; TCGA STAD -0.323; TCGA UCEC -0.292
hsa-miR-429
CLIP4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.237; TCGA BRCA -0.307; TCGA CESC -0.289; TCGA COAD -0.786; TCGA ESCA -0.399; TCGA HNSC -0.131; TCGA KIRP -0.229; TCGA LIHC -0.08; TCGA LUAD -0.171; TCGA PAAD -0.119; TCGA STAD -0.431; TCGA UCEC -0.232
hsa-miR-429
CRTC3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.063; TCGA BRCA -0.077; TCGA CESC -0.103; TCGA COAD -0.098; TCGA ESCA -0.11; TCGA HNSC -0.069; TCGA KIRC -0.086; TCGA LUAD -0.076; TCGA LUSC -0.066; TCGA PAAD -0.123; TCGA STAD -0.151; TCGA UCEC -0.099
hsa-miR-429
PRKD3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.054; TCGA BRCA -0.166; TCGA CESC -0.076; TCGA COAD -0.083; TCGA ESCA -0.117; TCGA HNSC -0.109; TCGA LUAD -0.147; TCGA LUSC -0.116; TCGA PAAD -0.26; TCGA STAD -0.142; TCGA UCEC -0.129
hsa-miR-429
CD1D
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.238; TCGA BRCA -0.086; TCGA CESC -0.314; TCGA COAD -0.28; TCGA ESCA -0.127; TCGA HNSC -0.178; TCGA KIRC -0.469; TCGA LUAD -0.152; TCGA LUSC -0.325; TCGA PAAD -0.423; TCGA STAD -0.091; TCGA UCEC -0.072
hsa-miR-429
LEPR
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.175; TCGA BRCA -0.483; TCGA CESC -0.224; TCGA COAD -0.249; TCGA ESCA -0.172; TCGA HNSC -0.229; TCGA LIHC -0.255; TCGA LUAD -0.18; TCGA LUSC -0.328; TCGA PAAD -0.273; TCGA PRAD -0.083; TCGA STAD -0.277; TCGA UCEC -0.397
hsa-miR-429
MS4A2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.297; TCGA BRCA -0.418; TCGA CESC -0.323; TCGA COAD -0.676; TCGA ESCA -0.261; TCGA HNSC -0.279; TCGA KIRC -0.421; TCGA LUAD -0.195; TCGA LUSC -0.53; TCGA PAAD -0.262; TCGA PRAD -0.134; TCGA STAD -0.284; TCGA UCEC -0.388
hsa-miR-429
OAS2
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.093; TCGA CESC -0.225; TCGA COAD -0.349; TCGA HNSC -0.142; TCGA KIRC -0.304; TCGA KIRP -0.142; TCGA LUAD -0.19; TCGA LUSC -0.229; TCGA PAAD -0.167
hsa-miR-429
ABCD2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.465; TCGA BRCA -0.618; TCGA CESC -0.441; TCGA COAD -0.524; TCGA ESCA -0.316; TCGA HNSC -0.324; TCGA KIRC -0.254; TCGA LUAD -0.237; TCGA LUSC -0.523; TCGA PAAD -0.553; TCGA PRAD -0.096; TCGA STAD -0.319; TCGA UCEC -0.415
hsa-miR-429
CCR1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda; miRNATAP
TCGA BLCA -0.323; TCGA CESC -0.289; TCGA COAD -0.431; TCGA ESCA -0.3; TCGA HNSC -0.371; TCGA KIRC -0.261; TCGA KIRP -0.336; TCGA LUAD -0.283; TCGA LUSC -0.545; TCGA PAAD -0.487; TCGA PRAD -0.093
hsa-miR-429
RANBP6
10 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.055; TCGA BRCA -0.052; TCGA ESCA -0.084; TCGA HNSC -0.19; TCGA LUAD -0.08; TCGA LUSC -0.115; TCGA OV -0.062; TCGA PAAD -0.132; TCGA STAD -0.081; TCGA UCEC -0.072
hsa-miR-429
LIFR
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.295; TCGA BRCA -0.42; TCGA CESC -0.245; TCGA COAD -0.681; TCGA ESCA -0.274; TCGA HNSC -0.231; TCGA LUSC -0.23; TCGA PAAD -0.34; TCGA PRAD -0.086; TCGA THCA -0.086; TCGA STAD -0.273; TCGA UCEC -0.34
hsa-miR-429
CPEB2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.137; TCGA BRCA -0.081; TCGA CESC -0.103; TCGA ESCA -0.103; TCGA HNSC -0.19; TCGA KIRC -0.062; TCGA KIRP -0.175; TCGA LUSC -0.106; TCGA STAD -0.086; TCGA UCEC -0.083
hsa-miR-429
GPR85
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.126; TCGA CESC -0.35; TCGA COAD -0.443; TCGA ESCA -0.21; TCGA HNSC -0.13; TCGA KIRC -0.509; TCGA LUAD -0.191; TCGA LUSC -0.152; TCGA OV -0.103; TCGA PAAD -0.331; TCGA STAD -0.101; TCGA UCEC -0.131
hsa-miR-429
EPDR1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.337; TCGA BRCA -0.343; TCGA CESC -0.17; TCGA ESCA -0.283; TCGA HNSC -0.468; TCGA KIRC -0.133; TCGA KIRP -0.448; TCGA LUSC -0.417; TCGA PAAD -0.143; TCGA PRAD -0.1; TCGA THCA -0.096; TCGA STAD -0.177; TCGA UCEC -0.256
hsa-miR-429
DST
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.335; TCGA CESC -0.326; TCGA COAD -0.173; TCGA ESCA -0.175; TCGA HNSC -0.146; TCGA KIRP -0.103; TCGA LUAD -0.192; TCGA STAD -0.269; TCGA UCEC -0.211
hsa-miR-429
ZNF366
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.164; TCGA BRCA -0.421; TCGA CESC -0.36; TCGA COAD -0.474; TCGA HNSC -0.43; TCGA LUAD -0.263; TCGA LUSC -0.53; TCGA PAAD -0.377; TCGA PRAD -0.109; TCGA STAD -0.136; TCGA UCEC -0.298
hsa-miR-429
NEK1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.08; TCGA BRCA -0.1; TCGA COAD -0.138; TCGA ESCA -0.126; TCGA HNSC -0.093; TCGA LIHC -0.069; TCGA LUAD -0.092; TCGA LUSC -0.147; TCGA PAAD -0.137; TCGA STAD -0.131; TCGA UCEC -0.117
hsa-miR-429
OLFML2A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.249; TCGA BRCA -0.219; TCGA CESC -0.364; TCGA COAD -0.303; TCGA ESCA -0.214; TCGA KIRC -0.54; TCGA LUAD -0.159; TCGA PAAD -0.116; TCGA PRAD -0.092; TCGA STAD -0.219; TCGA UCEC -0.351
hsa-miR-429
STARD8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.301; TCGA BRCA -0.262; TCGA CESC -0.345; TCGA COAD -0.444; TCGA ESCA -0.153; TCGA HNSC -0.416; TCGA LIHC -0.055; TCGA LUAD -0.293; TCGA LUSC -0.562; TCGA PAAD -0.34; TCGA PRAD -0.15; TCGA STAD -0.161; TCGA UCEC -0.28
hsa-miR-429
CPNE8
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.286; TCGA BRCA -0.239; TCGA CESC -0.267; TCGA COAD -0.297; TCGA ESCA -0.182; TCGA KIRC -0.107; TCGA KIRP -0.118; TCGA LIHC -0.052; TCGA LUAD -0.08; TCGA PAAD -0.099; TCGA STAD -0.222; TCGA UCEC -0.227
hsa-miR-429
OGN
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.719; TCGA BRCA -0.72; TCGA CESC -0.505; TCGA COAD -1.498; TCGA ESCA -0.591; TCGA HNSC -0.684; TCGA LUAD -0.188; TCGA LUSC -0.833; TCGA PAAD -0.749; TCGA PRAD -0.173; TCGA STAD -0.772; TCGA UCEC -0.877
hsa-miR-429
SCN9A
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.481; TCGA COAD -0.758; TCGA ESCA -0.343; TCGA KIRC -0.406; TCGA LIHC -0.139; TCGA OV -0.386; TCGA STAD -0.404; TCGA UCEC -0.178
hsa-miR-429
RNF217
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; STAD
miRanda
TCGA BLCA -0.321; TCGA BRCA -0.22; TCGA CESC -0.122; TCGA COAD -0.402; TCGA ESCA -0.471; TCGA KIRC -0.148; TCGA KIRP -0.216; TCGA LIHC -0.149; TCGA LUAD -0.147; TCGA PAAD -0.237; TCGA STAD -0.343
hsa-miR-429
LRCH1
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.136; TCGA BRCA -0.16; TCGA CESC -0.16; TCGA HNSC -0.174; TCGA LUAD -0.135; TCGA LUSC -0.237; TCGA PAAD -0.078; TCGA STAD -0.12; TCGA UCEC -0.191
hsa-miR-429
EMP1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.253; TCGA BRCA -0.315; TCGA CESC -0.14; TCGA COAD -0.297; TCGA HNSC -0.113; TCGA KIRC -0.085; TCGA LUAD -0.206; TCGA LUSC -0.157; TCGA PAAD -0.227; TCGA PRAD -0.135; TCGA STAD -0.201; TCGA UCEC -0.091
hsa-miR-429
LOX
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.387; TCGA BRCA -0.222; TCGA CESC -0.182; TCGA COAD -0.57; TCGA ESCA -0.292; TCGA HNSC -0.373; TCGA KIRC -0.849; TCGA KIRP -0.221; TCGA LUAD -0.298; TCGA LUSC -0.131; TCGA PAAD -0.31; TCGA STAD -0.074
hsa-miR-429
PI4K2A
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.055; TCGA CESC -0.108; TCGA COAD -0.113; TCGA ESCA -0.114; TCGA HNSC -0.132; TCGA KIRP -0.154; TCGA LUAD -0.12; TCGA LUSC -0.084; TCGA PAAD -0.112; TCGA PRAD -0.052; TCGA STAD -0.07
hsa-miR-429
TAP2
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.15; TCGA CESC -0.175; TCGA HNSC -0.084; TCGA KIRC -0.177; TCGA KIRP -0.107; TCGA LIHC -0.057; TCGA LUAD -0.174; TCGA LUSC -0.153; TCGA PAAD -0.119
hsa-miR-429
ROCK1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.095; TCGA BRCA -0.107; TCGA COAD -0.092; TCGA ESCA -0.065; TCGA HNSC -0.097; TCGA LUAD -0.077; TCGA LUSC -0.121; TCGA PAAD -0.095; TCGA STAD -0.111; TCGA UCEC -0.103
hsa-miR-429
CLEC4E
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.501; TCGA CESC -0.327; TCGA COAD -0.747; TCGA ESCA -0.241; TCGA HNSC -0.193; TCGA KIRC -0.19; TCGA LUAD -0.367; TCGA LUSC -0.511; TCGA PAAD -0.592; TCGA PRAD -0.091
hsa-miR-429
TGFBR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.101; TCGA CESC -0.22; TCGA COAD -0.176; TCGA ESCA -0.104; TCGA HNSC -0.156; TCGA KIRP -0.16; TCGA LUAD -0.063; TCGA LUSC -0.159; TCGA PAAD -0.111; TCGA PRAD -0.055; TCGA STAD -0.16; TCGA UCEC -0.112
hsa-miR-429
P2RY12
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.463; TCGA BRCA -0.46; TCGA CESC -0.461; TCGA COAD -0.527; TCGA ESCA -0.438; TCGA HNSC -0.502; TCGA KIRC -0.271; TCGA KIRP -0.248; TCGA LUAD -0.329; TCGA LUSC -0.762; TCGA PAAD -0.5; TCGA PRAD -0.112; TCGA STAD -0.424
hsa-miR-429
OXCT1
9 cancers: BLCA; BRCA; ESCA; KIRP; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.337; TCGA BRCA -0.162; TCGA ESCA -0.193; TCGA KIRP -0.198; TCGA PAAD -0.077; TCGA PRAD -0.076; TCGA THCA -0.067; TCGA STAD -0.157; TCGA UCEC -0.07
hsa-miR-429
PHLDB2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.25; TCGA BRCA -0.323; TCGA CESC -0.434; TCGA COAD -0.701; TCGA ESCA -0.462; TCGA LUAD -0.291; TCGA PAAD -0.212; TCGA STAD -0.387; TCGA UCEC -0.339
hsa-miR-429
CLIP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.065; TCGA BRCA -0.06; TCGA CESC -0.158; TCGA COAD -0.123; TCGA ESCA -0.158; TCGA HNSC -0.132; TCGA KIRP -0.092; TCGA LUAD -0.127; TCGA LUSC -0.06; TCGA PAAD -0.058; TCGA PRAD -0.057; TCGA STAD -0.193; TCGA UCEC -0.075
hsa-miR-429
NCS1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.238; TCGA CESC -0.265; TCGA COAD -0.283; TCGA ESCA -0.456; TCGA HNSC -0.064; TCGA KIRP -0.161; TCGA LUAD -0.084; TCGA PAAD -0.165; TCGA PRAD -0.07; TCGA STAD -0.455; TCGA UCEC -0.215
hsa-miR-429
ESYT2
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.069; TCGA ESCA -0.119; TCGA HNSC -0.075; TCGA KIRC -0.075; TCGA LUAD -0.068; TCGA LUSC -0.056; TCGA STAD -0.112; TCGA UCEC -0.076
hsa-miR-429
HLA-DRB1
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.357; TCGA CESC -0.259; TCGA COAD -0.393; TCGA HNSC -0.271; TCGA KIRC -0.27; TCGA KIRP -0.201; TCGA LUAD -0.171; TCGA LUSC -0.559; TCGA PAAD -0.382
hsa-miR-429
PCDH18
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.247; TCGA BRCA -0.389; TCGA CESC -0.241; TCGA COAD -0.274; TCGA HNSC -0.464; TCGA LUAD -0.168; TCGA LUSC -0.229; TCGA OV -0.103; TCGA PAAD -0.28; TCGA PRAD -0.111; TCGA STAD -0.118; TCGA UCEC -0.311
hsa-miR-429
MSR1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.38; TCGA CESC -0.291; TCGA COAD -0.682; TCGA ESCA -0.278; TCGA HNSC -0.391; TCGA KIRC -0.451; TCGA KIRP -0.5; TCGA LUAD -0.4; TCGA LUSC -0.764; TCGA PAAD -0.41; TCGA PRAD -0.098
hsa-miR-429
FILIP1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.415; TCGA BRCA -0.307; TCGA CESC -0.286; TCGA COAD -0.664; TCGA ESCA -0.35; TCGA HNSC -0.374; TCGA KIRC -0.274; TCGA KIRP -0.191; TCGA LUAD -0.139; TCGA LUSC -0.369; TCGA OV -0.295; TCGA PAAD -0.384; TCGA PRAD -0.232; TCGA STAD -0.548; TCGA UCEC -0.167
hsa-miR-429
RASSF8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.286; TCGA BRCA -0.183; TCGA CESC -0.212; TCGA COAD -0.533; TCGA ESCA -0.356; TCGA HNSC -0.362; TCGA KIRP -0.169; TCGA LUAD -0.265; TCGA LUSC -0.227; TCGA PAAD -0.293; TCGA PRAD -0.075; TCGA STAD -0.429; TCGA UCEC -0.386
hsa-miR-429
EDA2R
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.224; TCGA CESC -0.394; TCGA COAD -0.467; TCGA ESCA -0.257; TCGA HNSC -0.482; TCGA KIRC -0.392; TCGA KIRP -0.246; TCGA LUAD -0.148; TCGA LUSC -0.397; TCGA PAAD -0.266; TCGA PRAD -0.104; TCGA STAD -0.316; TCGA UCEC -0.276
hsa-miR-429
FLRT2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.419; TCGA BRCA -0.458; TCGA CESC -0.428; TCGA COAD -0.764; TCGA ESCA -0.506; TCGA HNSC -0.508; TCGA LUAD -0.298; TCGA LUSC -0.289; TCGA PAAD -0.321; TCGA PRAD -0.124; TCGA STAD -0.347; TCGA UCEC -0.418
hsa-miR-429
ZFHX4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.422; TCGA BRCA -0.394; TCGA CESC -0.214; TCGA COAD -1.014; TCGA ESCA -0.447; TCGA HNSC -0.347; TCGA KIRP -0.387; TCGA LIHC -0.1; TCGA LUAD -0.14; TCGA OV -0.168; TCGA PAAD -0.434; TCGA STAD -0.407; TCGA UCEC -0.383
hsa-miR-429
NPR3
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.258; TCGA BRCA -0.266; TCGA COAD -0.993; TCGA ESCA -0.402; TCGA LUAD -0.215; TCGA PAAD -0.19; TCGA PRAD -0.163; TCGA STAD -0.509; TCGA UCEC -0.136
hsa-miR-429
GLIPR2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.408; TCGA BRCA -0.107; TCGA CESC -0.24; TCGA COAD -0.341; TCGA ESCA -0.351; TCGA HNSC -0.277; TCGA KIRC -0.27; TCGA LUAD -0.241; TCGA LUSC -0.425; TCGA OV -0.1; TCGA PAAD -0.368; TCGA PRAD -0.065; TCGA STAD -0.246; TCGA UCEC -0.188
hsa-miR-429
PCDHGA11
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.172; TCGA BRCA -0.262; TCGA CESC -0.272; TCGA COAD -0.221; TCGA ESCA -0.214; TCGA HNSC -0.32; TCGA LUAD -0.207; TCGA LUSC -0.298; TCGA PAAD -0.129; TCGA UCEC -0.251
hsa-miR-429
HGF
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.521; TCGA BRCA -0.39; TCGA CESC -0.32; TCGA COAD -0.631; TCGA ESCA -0.207; TCGA HNSC -0.407; TCGA LUAD -0.329; TCGA LUSC -0.626; TCGA PAAD -0.518; TCGA PRAD -0.127; TCGA STAD -0.175; TCGA UCEC -0.278
hsa-miR-429
LRFN5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.426; TCGA BRCA -0.498; TCGA CESC -0.342; TCGA COAD -0.736; TCGA ESCA -0.378; TCGA HNSC -0.401; TCGA LIHC -0.121; TCGA LUAD -0.277; TCGA LUSC -0.35; TCGA OV -0.195; TCGA PAAD -0.42; TCGA STAD -0.425; TCGA UCEC -0.431
hsa-miR-429
COL21A1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.308; TCGA BRCA -0.22; TCGA COAD -0.415; TCGA ESCA -0.218; TCGA KIRC -0.386; TCGA LIHC -0.084; TCGA PAAD -0.432; TCGA PRAD -0.13; TCGA STAD -0.501
hsa-miR-429
RUNDC3B
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.122; TCGA BRCA -0.319; TCGA CESC -0.238; TCGA ESCA -0.154; TCGA HNSC -0.127; TCGA LIHC -0.209; TCGA LUAD -0.161; TCGA LUSC -0.318; TCGA PAAD -0.148; TCGA PRAD -0.137; TCGA STAD -0.232; TCGA UCEC -0.221
hsa-miR-429
HSPA13
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.112; TCGA CESC -0.068; TCGA COAD -0.066; TCGA ESCA -0.097; TCGA HNSC -0.106; TCGA KIRC -0.103; TCGA KIRP -0.204; TCGA LUAD -0.124; TCGA LUSC -0.121; TCGA PAAD -0.123; TCGA PRAD -0.065; TCGA UCEC -0.129
hsa-miR-429
ARSB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.171; TCGA BRCA -0.059; TCGA CESC -0.074; TCGA COAD -0.147; TCGA ESCA -0.234; TCGA HNSC -0.242; TCGA KIRC -0.093; TCGA KIRP -0.203; TCGA LIHC -0.06; TCGA LUAD -0.163; TCGA LUSC -0.223; TCGA PAAD -0.193; TCGA STAD -0.182; TCGA UCEC -0.058
hsa-miR-429
EDNRA
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.346; TCGA BRCA -0.167; TCGA CESC -0.342; TCGA COAD -0.384; TCGA ESCA -0.171; TCGA HNSC -0.406; TCGA KIRC -0.31; TCGA LUAD -0.203; TCGA LUSC -0.374; TCGA OV -0.223; TCGA PAAD -0.289; TCGA PRAD -0.106; TCGA STAD -0.301; TCGA UCEC -0.398
hsa-miR-429
ANO5
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUSC; OV; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.173; TCGA BRCA -0.376; TCGA COAD -0.627; TCGA HNSC -0.599; TCGA LIHC -0.132; TCGA LUSC -0.381; TCGA OV -0.257; TCGA THCA -0.094; TCGA STAD -0.425; TCGA UCEC -0.352
hsa-miR-429
CD34
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.178; TCGA BRCA -0.348; TCGA CESC -0.259; TCGA COAD -0.34; TCGA ESCA -0.133; TCGA HNSC -0.29; TCGA KIRC -0.145; TCGA LIHC -0.078; TCGA LUAD -0.161; TCGA LUSC -0.384; TCGA PAAD -0.241; TCGA PRAD -0.091; TCGA STAD -0.197; TCGA UCEC -0.223
hsa-miR-429
IL33
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.38; TCGA BRCA -0.568; TCGA CESC -0.489; TCGA ESCA -0.239; TCGA HNSC -0.383; TCGA KIRC -0.159; TCGA LUAD -0.13; TCGA LUSC -0.336; TCGA PAAD -0.394; TCGA PRAD -0.103; TCGA THCA -0.056; TCGA STAD -0.311; TCGA UCEC -0.286
hsa-miR-429
TRANK1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.066; TCGA CESC -0.176; TCGA COAD -0.129; TCGA ESCA -0.091; TCGA HNSC -0.236; TCGA KIRC -0.243; TCGA LIHC -0.068; TCGA LUAD -0.09; TCGA LUSC -0.343; TCGA PAAD -0.146; TCGA STAD -0.061; TCGA UCEC -0.163
hsa-miR-429
EBF3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.205; TCGA BRCA -0.496; TCGA CESC -0.238; TCGA COAD -0.708; TCGA ESCA -0.281; TCGA HNSC -0.326; TCGA KIRC -0.367; TCGA PAAD -0.318; TCGA PRAD -0.098; TCGA STAD -0.305; TCGA UCEC -0.323
hsa-miR-429
GABARAPL1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.124; TCGA BRCA -0.238; TCGA CESC -0.231; TCGA COAD -0.268; TCGA ESCA -0.172; TCGA KIRP -0.127; TCGA LIHC -0.076; TCGA LUAD -0.091; TCGA STAD -0.248; TCGA UCEC -0.166
hsa-miR-429
PLOD2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.223; TCGA BRCA -0.108; TCGA CESC -0.133; TCGA COAD -0.132; TCGA ESCA -0.159; TCGA HNSC -0.101; TCGA KIRC -0.347; TCGA KIRP -0.096; TCGA LUAD -0.215; TCGA PAAD -0.136; TCGA PRAD -0.066; TCGA STAD -0.128
hsa-miR-429
CDH6
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.248; TCGA COAD -0.308; TCGA HNSC -0.232; TCGA KIRC -0.317; TCGA LUAD -0.106; TCGA LUSC -0.284; TCGA PRAD -0.098; TCGA STAD -0.096
hsa-miR-429
RNF122
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.122; TCGA BRCA -0.078; TCGA COAD -0.184; TCGA ESCA -0.264; TCGA HNSC -0.167; TCGA KIRC -0.144; TCGA LUAD -0.087; TCGA LUSC -0.153; TCGA PAAD -0.244; TCGA PRAD -0.075; TCGA STAD -0.167
hsa-miR-429
ITGB3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.459; TCGA BRCA -0.311; TCGA CESC -0.347; TCGA COAD -0.538; TCGA ESCA -0.228; TCGA HNSC -0.515; TCGA LIHC -0.109; TCGA LUAD -0.208; TCGA LUSC -0.503; TCGA PAAD -0.323; TCGA PRAD -0.168; TCGA STAD -0.252; TCGA UCEC -0.228
hsa-miR-429
GREB1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.177; TCGA CESC -0.243; TCGA COAD -0.439; TCGA ESCA -0.237; TCGA HNSC -0.235; TCGA KIRP -0.473; TCGA LIHC -0.106; TCGA LUSC -0.174; TCGA PAAD -0.293; TCGA PRAD -0.129; TCGA STAD -0.243; TCGA UCEC -0.083
hsa-miR-429
CDON
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.325; TCGA BRCA -0.127; TCGA COAD -0.345; TCGA ESCA -0.159; TCGA KIRC -0.424; TCGA KIRP -0.301; TCGA OV -0.102; TCGA PAAD -0.189; TCGA STAD -0.445; TCGA UCEC -0.315
hsa-miR-429
KCNMB1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.493; TCGA BRCA -0.252; TCGA CESC -0.533; TCGA COAD -0.924; TCGA ESCA -0.485; TCGA HNSC -0.263; TCGA KIRC -0.294; TCGA KIRP -0.173; TCGA LUAD -0.117; TCGA LUSC -0.415; TCGA PAAD -0.319; TCGA PRAD -0.087; TCGA STAD -0.65; TCGA UCEC -0.496
hsa-miR-429
KLHDC1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.066; TCGA BRCA -0.2; TCGA COAD -0.265; TCGA ESCA -0.169; TCGA HNSC -0.151; TCGA LIHC -0.087; TCGA LUSC -0.217; TCGA STAD -0.268; TCGA UCEC -0.282
hsa-miR-429
KLHL13
9 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.322; TCGA BRCA -0.387; TCGA ESCA -0.358; TCGA KIRP -0.301; TCGA LIHC -0.135; TCGA PAAD -0.155; TCGA PRAD -0.073; TCGA STAD -0.342; TCGA UCEC -0.235
hsa-miR-429
PDE5A
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.205; TCGA BRCA -0.266; TCGA COAD -0.326; TCGA ESCA -0.217; TCGA HNSC -0.106; TCGA LUAD -0.149; TCGA LUSC -0.336; TCGA PRAD -0.16; TCGA STAD -0.305; TCGA UCEC -0.251
hsa-miR-429
RGS1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA
miRanda
TCGA BLCA -0.417; TCGA CESC -0.237; TCGA COAD -0.422; TCGA ESCA -0.227; TCGA HNSC -0.155; TCGA KIRC -0.644; TCGA KIRP -0.368; TCGA LUAD -0.118; TCGA LUSC -0.364; TCGA PAAD -0.371; TCGA THCA -0.088
hsa-miR-429
FBXL3
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; OV; PAAD; UCEC
miRanda
TCGA BLCA -0.051; TCGA BRCA -0.138; TCGA CESC -0.057; TCGA HNSC -0.104; TCGA LUAD -0.084; TCGA LUSC -0.127; TCGA OV -0.06; TCGA PAAD -0.101; TCGA UCEC -0.189
hsa-miR-429
POU6F1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.202; TCGA BRCA -0.174; TCGA CESC -0.13; TCGA COAD -0.256; TCGA ESCA -0.249; TCGA HNSC -0.225; TCGA LUSC -0.222; TCGA PAAD -0.168; TCGA STAD -0.343; TCGA UCEC -0.187
hsa-miR-429
OSMR
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.462; TCGA BRCA -0.182; TCGA CESC -0.266; TCGA COAD -0.689; TCGA ESCA -0.217; TCGA HNSC -0.194; TCGA KIRC -0.341; TCGA KIRP -0.246; TCGA LUAD -0.212; TCGA LUSC -0.098; TCGA PAAD -0.233; TCGA PRAD -0.076; TCGA STAD -0.178; TCGA UCEC -0.095
hsa-miR-429
FYB
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.408; TCGA CESC -0.347; TCGA COAD -0.43; TCGA ESCA -0.246; TCGA HNSC -0.345; TCGA KIRC -0.319; TCGA KIRP -0.302; TCGA LUAD -0.226; TCGA LUSC -0.413; TCGA PAAD -0.45; TCGA UCEC -0.073
hsa-miR-429
GNAI1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.092; TCGA BRCA -0.378; TCGA CESC -0.233; TCGA COAD -0.206; TCGA ESCA -0.328; TCGA HNSC -0.077; TCGA LIHC -0.074; TCGA OV -0.112; TCGA STAD -0.242; TCGA UCEC -0.159
hsa-miR-429
GPRASP1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.146; TCGA BRCA -0.371; TCGA CESC -0.186; TCGA COAD -0.521; TCGA ESCA -0.318; TCGA HNSC -0.138; TCGA LUSC -0.223; TCGA PAAD -0.184; TCGA STAD -0.511; TCGA UCEC -0.454
hsa-miR-429
KDSR
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.069; TCGA BRCA -0.071; TCGA CESC -0.127; TCGA ESCA -0.091; TCGA KIRC -0.06; TCGA LUAD -0.066; TCGA PAAD -0.071; TCGA STAD -0.062; TCGA UCEC -0.122
hsa-miR-429
PTGER3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.501; TCGA BRCA -0.389; TCGA CESC -0.516; TCGA COAD -0.947; TCGA ESCA -0.408; TCGA HNSC -0.396; TCGA LIHC -0.075; TCGA LUAD -0.2; TCGA LUSC -0.362; TCGA OV -0.283; TCGA PAAD -0.375; TCGA PRAD -0.126; TCGA STAD -0.398; TCGA UCEC -0.719
hsa-miR-429
TAL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.121; TCGA BRCA -0.354; TCGA CESC -0.347; TCGA COAD -0.459; TCGA ESCA -0.144; TCGA HNSC -0.176; TCGA KIRC -0.134; TCGA LUAD -0.179; TCGA LUSC -0.313; TCGA PAAD -0.306; TCGA PRAD -0.077; TCGA STAD -0.184; TCGA UCEC -0.365
hsa-miR-429
RSU1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.055; TCGA CESC -0.096; TCGA COAD -0.068; TCGA ESCA -0.073; TCGA HNSC -0.11; TCGA KIRC -0.104; TCGA KIRP -0.127; TCGA LUAD -0.082; TCGA LUSC -0.184; TCGA PAAD -0.161; TCGA PRAD -0.063; TCGA STAD -0.125; TCGA UCEC -0.082
hsa-miR-429
MEF2C
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.281; TCGA BRCA -0.268; TCGA CESC -0.356; TCGA COAD -0.439; TCGA ESCA -0.227; TCGA HNSC -0.573; TCGA KIRC -0.264; TCGA KIRP -0.144; TCGA LUAD -0.131; TCGA LUSC -0.451; TCGA PAAD -0.388; TCGA PRAD -0.154; TCGA STAD -0.279; TCGA UCEC -0.342
hsa-miR-429
TICAM2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.198; TCGA BRCA -0.09; TCGA CESC -0.135; TCGA COAD -0.407; TCGA ESCA -0.291; TCGA HNSC -0.246; TCGA KIRC -0.229; TCGA LIHC -0.107; TCGA LUAD -0.186; TCGA LUSC -0.29; TCGA PAAD -0.097; TCGA UCEC -0.119
hsa-miR-429
MRAS
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.305; TCGA BRCA -0.296; TCGA CESC -0.252; TCGA COAD -0.588; TCGA ESCA -0.303; TCGA HNSC -0.423; TCGA KIRP -0.115; TCGA LUAD -0.186; TCGA LUSC -0.445; TCGA PAAD -0.339; TCGA PRAD -0.061; TCGA STAD -0.289; TCGA UCEC -0.201
hsa-miR-429
RAB27A
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; UCEC
miRanda
TCGA BLCA -0.249; TCGA BRCA -0.059; TCGA CESC -0.121; TCGA COAD -0.129; TCGA HNSC -0.095; TCGA KIRC -0.058; TCGA KIRP -0.094; TCGA LUAD -0.08; TCGA LUSC -0.314; TCGA PRAD -0.178; TCGA UCEC -0.086
hsa-miR-429
LIMS1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda; miRNATAP
TCGA BLCA -0.118; TCGA BRCA -0.178; TCGA CESC -0.115; TCGA COAD -0.16; TCGA HNSC -0.251; TCGA KIRC -0.178; TCGA KIRP -0.269; TCGA LUAD -0.219; TCGA LUSC -0.159; TCGA PAAD -0.197; TCGA PRAD -0.102; TCGA THCA -0.055; TCGA STAD -0.06
hsa-miR-429
SLA
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
miRanda
TCGA BLCA -0.389; TCGA CESC -0.286; TCGA COAD -0.474; TCGA ESCA -0.213; TCGA HNSC -0.268; TCGA KIRC -0.354; TCGA KIRP -0.275; TCGA LUAD -0.271; TCGA LUSC -0.527; TCGA PAAD -0.529; TCGA THCA -0.051; TCGA STAD -0.082
hsa-miR-429
PRKCQ
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.256; TCGA BRCA -0.11; TCGA CESC -0.256; TCGA ESCA -0.356; TCGA HNSC -0.299; TCGA LUAD -0.175; TCGA LUSC -0.416; TCGA PAAD -0.397; TCGA STAD -0.175
hsa-miR-429
CYBB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.476; TCGA BRCA -0.112; TCGA CESC -0.32; TCGA COAD -0.471; TCGA ESCA -0.206; TCGA HNSC -0.397; TCGA KIRC -0.388; TCGA KIRP -0.337; TCGA LUAD -0.371; TCGA LUSC -0.664; TCGA PAAD -0.491; TCGA PRAD -0.086; TCGA STAD -0.082; TCGA UCEC -0.075
hsa-miR-429
SNCA
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.29; TCGA BRCA -0.305; TCGA CESC -0.31; TCGA COAD -0.729; TCGA ESCA -0.291; TCGA HNSC -0.129; TCGA KIRP -0.355; TCGA LUAD -0.239; TCGA OV -0.25; TCGA STAD -0.318; TCGA UCEC -0.383
hsa-miR-429
PTPN5
9 cancers: BLCA; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.251; TCGA ESCA -0.256; TCGA HNSC -0.378; TCGA LUAD -0.298; TCGA LUSC -0.471; TCGA PAAD -0.321; TCGA PRAD -0.127; TCGA STAD -0.409; TCGA UCEC -0.318
hsa-miR-429
SERPINI1
10 cancers: BLCA; BRCA; CESC; COAD; KIRP; LIHC; LUAD; OV; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.124; TCGA CESC -0.147; TCGA COAD -0.263; TCGA KIRP -0.2; TCGA LIHC -0.074; TCGA LUAD -0.08; TCGA OV -0.219; TCGA STAD -0.112; TCGA UCEC -0.199
hsa-miR-429
FLT4
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.086; TCGA BRCA -0.22; TCGA CESC -0.239; TCGA COAD -0.416; TCGA HNSC -0.323; TCGA KIRC -0.204; TCGA LUAD -0.219; TCGA LUSC -0.428; TCGA PAAD -0.213; TCGA PRAD -0.1; TCGA STAD -0.119; TCGA UCEC -0.261
hsa-miR-429
ABCB4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.255; TCGA BRCA -0.105; TCGA CESC -0.204; TCGA COAD -0.279; TCGA ESCA -0.178; TCGA HNSC -0.381; TCGA KIRC -0.353; TCGA KIRP -0.189; TCGA LIHC -0.329; TCGA LUSC -0.24; TCGA OV -0.135; TCGA PAAD -0.191; TCGA STAD -0.18; TCGA UCEC -0.108
hsa-miR-429
NLRP3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.457; TCGA BRCA -0.192; TCGA CESC -0.366; TCGA COAD -0.409; TCGA ESCA -0.237; TCGA HNSC -0.349; TCGA KIRC -0.316; TCGA KIRP -0.15; TCGA LUAD -0.263; TCGA LUSC -0.579; TCGA PAAD -0.401; TCGA PRAD -0.073; TCGA STAD -0.122; TCGA UCEC -0.123
hsa-miR-429
TMTC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.266; TCGA BRCA -0.508; TCGA CESC -0.202; TCGA COAD -0.485; TCGA ESCA -0.347; TCGA HNSC -0.214; TCGA LIHC -0.087; TCGA LUAD -0.119; TCGA PAAD -0.329; TCGA PRAD -0.1; TCGA STAD -0.479; TCGA UCEC -0.235
hsa-miR-429
CSF3R
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.22; TCGA CESC -0.203; TCGA COAD -0.514; TCGA ESCA -0.144; TCGA HNSC -0.195; TCGA KIRC -0.506; TCGA LUSC -0.407; TCGA PAAD -0.397; TCGA PRAD -0.081
hsa-miR-429
GUCY1B3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.168; TCGA BRCA -0.131; TCGA CESC -0.138; TCGA COAD -0.604; TCGA ESCA -0.278; TCGA HNSC -0.205; TCGA KIRC -0.212; TCGA KIRP -0.121; TCGA LUAD -0.067; TCGA LUSC -0.204; TCGA OV -0.136; TCGA PAAD -0.287; TCGA STAD -0.358; TCGA UCEC -0.151
hsa-miR-429
IL7
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.192; TCGA HNSC -0.155; TCGA KIRC -0.266; TCGA KIRP -0.156; TCGA LUAD -0.13; TCGA LUSC -0.243; TCGA OV -0.147; TCGA UCEC -0.122
hsa-miR-429
P2RY1
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.111; TCGA BRCA -0.249; TCGA CESC -0.22; TCGA KIRC -0.538; TCGA KIRP -0.309; TCGA LUAD -0.272; TCGA PAAD -0.316; TCGA STAD -0.238; TCGA UCEC -0.219
hsa-miR-429
LDLRAD3
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.165; TCGA CESC -0.247; TCGA ESCA -0.165; TCGA HNSC -0.298; TCGA KIRC -0.412; TCGA KIRP -0.357; TCGA LUAD -0.276; TCGA PAAD -0.278; TCGA PRAD -0.064; TCGA STAD -0.122; TCGA UCEC -0.082
hsa-miR-429
IL15
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.26; TCGA BRCA -0.081; TCGA CESC -0.253; TCGA ESCA -0.129; TCGA HNSC -0.145; TCGA KIRC -0.156; TCGA LIHC -0.056; TCGA LUAD -0.215; TCGA LUSC -0.292; TCGA PAAD -0.15; TCGA STAD -0.086
hsa-miR-429
TOR1AIP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.087; TCGA CESC -0.064; TCGA COAD -0.12; TCGA ESCA -0.118; TCGA HNSC -0.116; TCGA KIRP -0.063; TCGA LUAD -0.069; TCGA LUSC -0.159; TCGA PAAD -0.088; TCGA STAD -0.175; TCGA UCEC -0.126
hsa-miR-429
LDB3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.227; TCGA BRCA -0.323; TCGA COAD -0.929; TCGA ESCA -0.474; TCGA HNSC -0.836; TCGA LUSC -0.35; TCGA PAAD -0.354; TCGA PRAD -0.199; TCGA STAD -0.818; TCGA UCEC -0.263
hsa-miR-429
ARMCX1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.248; TCGA BRCA -0.058; TCGA CESC -0.305; TCGA COAD -0.592; TCGA ESCA -0.331; TCGA HNSC -0.303; TCGA LUAD -0.171; TCGA LUSC -0.252; TCGA OV -0.134; TCGA PAAD -0.169; TCGA STAD -0.358; TCGA UCEC -0.377
hsa-miR-429
CD70
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.442; TCGA CESC -0.408; TCGA COAD -0.435; TCGA HNSC -0.161; TCGA KIRC -1.454; TCGA KIRP -0.72; TCGA LUAD -0.275; TCGA LUSC -0.215; TCGA PAAD -0.331
hsa-miR-429
HSPA12A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.319; TCGA BRCA -0.316; TCGA CESC -0.162; TCGA COAD -0.199; TCGA ESCA -0.331; TCGA HNSC -0.37; TCGA LUAD -0.127; TCGA LUSC -0.309; TCGA PAAD -0.302; TCGA PRAD -0.09; TCGA STAD -0.337; TCGA UCEC -0.136
hsa-miR-429
EIF4E3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.052; TCGA BRCA -0.181; TCGA CESC -0.148; TCGA COAD -0.147; TCGA ESCA -0.164; TCGA HNSC -0.224; TCGA LUSC -0.383; TCGA PAAD -0.056; TCGA PRAD -0.086; TCGA STAD -0.208; TCGA UCEC -0.158
hsa-miR-429
CSF2RA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.317; TCGA BRCA -0.1; TCGA CESC -0.222; TCGA COAD -0.377; TCGA ESCA -0.177; TCGA HNSC -0.175; TCGA KIRC -0.357; TCGA KIRP -0.329; TCGA LUAD -0.275; TCGA LUSC -0.559; TCGA PAAD -0.447; TCGA STAD -0.098
hsa-miR-429
OSBPL1A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.182; TCGA BRCA -0.12; TCGA CESC -0.179; TCGA COAD -0.311; TCGA ESCA -0.137; TCGA HNSC -0.092; TCGA KIRP -0.122; TCGA LUSC -0.079; TCGA THCA -0.077; TCGA STAD -0.256; TCGA UCEC -0.236
hsa-miR-429
SEPT10
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.065; TCGA BRCA -0.14; TCGA CESC -0.188; TCGA ESCA -0.095; TCGA HNSC -0.096; TCGA LUAD -0.119; TCGA LUSC -0.077; TCGA STAD -0.113; TCGA UCEC -0.191
hsa-miR-429
USP12
10 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.131; TCGA BRCA -0.144; TCGA ESCA -0.057; TCGA HNSC -0.19; TCGA LUAD -0.108; TCGA LUSC -0.189; TCGA PRAD -0.098; TCGA THCA -0.052; TCGA STAD -0.118; TCGA UCEC -0.123
hsa-miR-429
LXN
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.079; TCGA CESC -0.167; TCGA COAD -0.181; TCGA HNSC -0.097; TCGA KIRC -0.174; TCGA KIRP -0.089; TCGA LUAD -0.172; TCGA LUSC -0.219; TCGA PAAD -0.109
hsa-miR-429
STK17A
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.178; TCGA BRCA -0.064; TCGA CESC -0.153; TCGA COAD -0.102; TCGA ESCA -0.126; TCGA HNSC -0.07; TCGA KIRC -0.074; TCGA LUAD -0.091; TCGA LUSC -0.082; TCGA PAAD -0.181
hsa-miR-429
GJA5
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.235; TCGA BRCA -0.208; TCGA CESC -0.366; TCGA COAD -0.521; TCGA HNSC -0.339; TCGA LUAD -0.209; TCGA LUSC -0.488; TCGA OV -0.178; TCGA PAAD -0.281; TCGA PRAD -0.088; TCGA STAD -0.072; TCGA UCEC -0.146
hsa-miR-429
ISM1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; THCA; STAD
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.413; TCGA CESC -0.201; TCGA COAD -0.983; TCGA ESCA -0.499; TCGA HNSC -0.404; TCGA LUSC -0.334; TCGA OV -0.278; TCGA PAAD -0.295; TCGA THCA -0.091; TCGA STAD -0.55
hsa-miR-429
CNTNAP3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.348; TCGA BRCA -0.408; TCGA CESC -0.282; TCGA COAD -0.725; TCGA ESCA -0.585; TCGA HNSC -0.185; TCGA LIHC -0.172; TCGA LUAD -0.161; TCGA THCA -0.089; TCGA STAD -0.479; TCGA UCEC -0.131
hsa-miR-429
IFI44L
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.246; TCGA CESC -0.236; TCGA COAD -0.598; TCGA ESCA -0.271; TCGA HNSC -0.224; TCGA KIRC -0.21; TCGA LUSC -0.35; TCGA PAAD -0.262; TCGA STAD -0.188
hsa-miR-429
IFIT3
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.255; TCGA CESC -0.295; TCGA COAD -0.297; TCGA HNSC -0.285; TCGA KIRC -0.082; TCGA KIRP -0.129; TCGA LIHC -0.07; TCGA LUAD -0.212; TCGA LUSC -0.368; TCGA PAAD -0.122
hsa-miR-429
SLFN12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.144; TCGA CESC -0.106; TCGA COAD -0.422; TCGA ESCA -0.12; TCGA HNSC -0.134; TCGA KIRC -0.191; TCGA LUAD -0.077; TCGA LUSC -0.196; TCGA PAAD -0.253; TCGA PRAD -0.091; TCGA STAD -0.078
hsa-miR-429
PPP3CB
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.104; TCGA BRCA -0.082; TCGA COAD -0.064; TCGA ESCA -0.091; TCGA HNSC -0.127; TCGA LUSC -0.112; TCGA PAAD -0.075; TCGA STAD -0.143; TCGA UCEC -0.101
hsa-miR-429
RFTN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.227; TCGA BRCA -0.215; TCGA CESC -0.384; TCGA COAD -0.435; TCGA ESCA -0.279; TCGA HNSC -0.319; TCGA KIRC -0.231; TCGA KIRP -0.234; TCGA LIHC -0.096; TCGA LUSC -0.434; TCGA PAAD -0.318; TCGA PRAD -0.129; TCGA STAD -0.172; TCGA UCEC -0.269
hsa-miR-429
TMEM100
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.341; TCGA BRCA -0.616; TCGA COAD -0.852; TCGA ESCA -0.231; TCGA HNSC -0.488; TCGA KIRC -0.303; TCGA KIRP -0.329; TCGA LIHC -0.103; TCGA LUAD -0.278; TCGA LUSC -0.61; TCGA PAAD -0.341; TCGA STAD -0.597; TCGA UCEC -0.332
hsa-miR-429
FAM198B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.191; TCGA BRCA -0.16; TCGA CESC -0.329; TCGA COAD -0.367; TCGA ESCA -0.126; TCGA HNSC -0.47; TCGA KIRC -0.257; TCGA KIRP -0.183; TCGA LUAD -0.145; TCGA LUSC -0.429; TCGA PAAD -0.264; TCGA STAD -0.186; TCGA UCEC -0.279
hsa-miR-429
TMEM55A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.205; TCGA BRCA -0.223; TCGA CESC -0.273; TCGA COAD -0.171; TCGA ESCA -0.141; TCGA HNSC -0.342; TCGA KIRP -0.193; TCGA LUAD -0.168; TCGA LUSC -0.298; TCGA OV -0.127; TCGA PAAD -0.058; TCGA PRAD -0.115; TCGA STAD -0.305; TCGA UCEC -0.334
hsa-miR-429
S1PR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.245; TCGA BRCA -0.376; TCGA CESC -0.331; TCGA COAD -0.505; TCGA ESCA -0.158; TCGA HNSC -0.385; TCGA KIRC -0.182; TCGA LUAD -0.281; TCGA LUSC -0.573; TCGA PAAD -0.387; TCGA PRAD -0.127; TCGA STAD -0.244; TCGA UCEC -0.267
hsa-miR-429
PTGER2
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.234; TCGA BRCA -0.232; TCGA CESC -0.309; TCGA HNSC -0.377; TCGA LUAD -0.234; TCGA LUSC -0.571; TCGA PAAD -0.221; TCGA PRAD -0.073; TCGA UCEC -0.187
hsa-miR-429
DCLK1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.502; TCGA BRCA -0.265; TCGA CESC -0.348; TCGA COAD -0.967; TCGA ESCA -0.585; TCGA HNSC -0.488; TCGA KIRC -0.498; TCGA KIRP -0.362; TCGA OV -0.233; TCGA PAAD -0.471; TCGA STAD -0.521; TCGA UCEC -0.317
hsa-miR-429
GPC6
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.527; TCGA BRCA -0.262; TCGA CESC -0.308; TCGA COAD -0.687; TCGA ESCA -0.322; TCGA HNSC -0.557; TCGA KIRC -0.181; TCGA LUAD -0.423; TCGA LUSC -0.501; TCGA PAAD -0.287; TCGA PRAD -0.068; TCGA STAD -0.234; TCGA UCEC -0.203
hsa-miR-429
ITM2A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.38; TCGA BRCA -0.448; TCGA CESC -0.5; TCGA COAD -0.492; TCGA ESCA -0.189; TCGA HNSC -0.384; TCGA LUAD -0.204; TCGA LUSC -0.44; TCGA OV -0.114; TCGA PAAD -0.377; TCGA PRAD -0.186; TCGA STAD -0.225; TCGA UCEC -0.487
hsa-miR-429
RASGRF2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.2; TCGA BRCA -0.375; TCGA CESC -0.292; TCGA COAD -0.278; TCGA HNSC -0.424; TCGA LIHC -0.16; TCGA LUAD -0.179; TCGA LUSC -0.552; TCGA PAAD -0.363; TCGA PRAD -0.15; TCGA STAD -0.166; TCGA UCEC -0.245
hsa-miR-429
CYYR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.12; TCGA BRCA -0.288; TCGA CESC -0.263; TCGA COAD -0.432; TCGA ESCA -0.139; TCGA HNSC -0.314; TCGA LUAD -0.205; TCGA LUSC -0.327; TCGA OV -0.144; TCGA PAAD -0.303; TCGA PRAD -0.099; TCGA STAD -0.199; TCGA UCEC -0.273
hsa-miR-429
WASF1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.084; TCGA CESC -0.126; TCGA COAD -0.26; TCGA ESCA -0.164; TCGA KIRC -0.17; TCGA KIRP -0.143; TCGA LUAD -0.131; TCGA PAAD -0.18; TCGA STAD -0.351
hsa-miR-429
ADAMTS4
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.364; TCGA CESC -0.252; TCGA COAD -0.412; TCGA ESCA -0.214; TCGA HNSC -0.368; TCGA KIRC -0.626; TCGA LUAD -0.351; TCGA LUSC -0.38; TCGA PAAD -0.209; TCGA PRAD -0.191; TCGA STAD -0.102; TCGA UCEC -0.093
hsa-miR-429
ENPEP
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.211; TCGA CESC -0.424; TCGA COAD -0.199; TCGA ESCA -0.13; TCGA HNSC -0.363; TCGA KIRC -0.189; TCGA KIRP -0.227; TCGA LIHC -0.196; TCGA LUAD -0.206; TCGA LUSC -0.266; TCGA PAAD -0.246; TCGA PRAD -0.195; TCGA STAD -0.092; TCGA UCEC -0.298
hsa-miR-429
AP1M1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; STAD
miRanda
TCGA BLCA -0.056; TCGA CESC -0.139; TCGA COAD -0.112; TCGA ESCA -0.113; TCGA HNSC -0.104; TCGA KIRC -0.061; TCGA KIRP -0.099; TCGA LIHC -0.052; TCGA LUAD -0.063; TCGA LUSC -0.081; TCGA STAD -0.123
hsa-miR-429
CNTLN
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.273; TCGA BRCA -0.137; TCGA COAD -0.192; TCGA ESCA -0.372; TCGA KIRC -0.178; TCGA KIRP -0.093; TCGA LIHC -0.071; TCGA LUAD -0.236; TCGA OV -0.085; TCGA PAAD -0.151; TCGA STAD -0.241; TCGA UCEC -0.154
hsa-miR-429
ARL2BP
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.081; TCGA BRCA -0.063; TCGA CESC -0.122; TCGA COAD -0.058; TCGA ESCA -0.111; TCGA KIRC -0.091; TCGA KIRP -0.152; TCGA LUSC -0.091; TCGA PAAD -0.093; TCGA STAD -0.086; TCGA UCEC -0.084
hsa-miR-429
ARHGEF6
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.134; TCGA BRCA -0.293; TCGA CESC -0.335; TCGA COAD -0.479; TCGA ESCA -0.27; TCGA HNSC -0.427; TCGA KIRC -0.275; TCGA KIRP -0.176; TCGA LUAD -0.227; TCGA LUSC -0.539; TCGA PAAD -0.415; TCGA PRAD -0.064; TCGA STAD -0.234; TCGA UCEC -0.269
hsa-miR-429
HDC
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.361; TCGA BRCA -0.308; TCGA CESC -0.26; TCGA COAD -0.539; TCGA ESCA -0.294; TCGA KIRC -0.348; TCGA LIHC -0.168; TCGA LUAD -0.142; TCGA LUSC -0.409; TCGA PAAD -0.352; TCGA STAD -0.208; TCGA UCEC -0.139
hsa-miR-429
LY96
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.394; TCGA BRCA -0.126; TCGA CESC -0.364; TCGA COAD -0.62; TCGA ESCA -0.23; TCGA HNSC -0.087; TCGA KIRC -0.329; TCGA KIRP -0.584; TCGA LUAD -0.094; TCGA LUSC -0.24; TCGA PAAD -0.444; TCGA STAD -0.094; TCGA UCEC -0.227
hsa-miR-429
RRN3P2
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.182; TCGA BRCA -0.062; TCGA CESC -0.24; TCGA ESCA -0.107; TCGA KIRC -0.287; TCGA LUAD -0.091; TCGA LUSC -0.26; TCGA PAAD -0.121; TCGA STAD -0.129
hsa-miR-429
ETV1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; OV; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.18; TCGA BRCA -0.23; TCGA COAD -0.264; TCGA HNSC -0.146; TCGA KIRC -0.09; TCGA LIHC -0.068; TCGA LUAD -0.109; TCGA LUSC -0.324; TCGA OV -0.155; TCGA STAD -0.19; TCGA UCEC -0.183
hsa-miR-429
ADCYAP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.351; TCGA BRCA -0.184; TCGA CESC -0.324; TCGA COAD -1.036; TCGA ESCA -0.532; TCGA HNSC -0.164; TCGA LUAD -0.154; TCGA LUSC -0.412; TCGA PAAD -0.277; TCGA PRAD -0.103; TCGA STAD -0.56; TCGA UCEC -0.405
hsa-miR-429
CXCL12
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.478; TCGA BRCA -0.378; TCGA CESC -0.487; TCGA COAD -0.456; TCGA ESCA -0.387; TCGA HNSC -0.553; TCGA LUAD -0.316; TCGA LUSC -0.566; TCGA OV -0.172; TCGA PAAD -0.606; TCGA PRAD -0.13; TCGA STAD -0.375; TCGA UCEC -0.525
hsa-miR-429
ADCY7
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.235; TCGA CESC -0.215; TCGA COAD -0.148; TCGA ESCA -0.179; TCGA HNSC -0.197; TCGA KIRC -0.344; TCGA KIRP -0.241; TCGA LUAD -0.105; TCGA LUSC -0.306; TCGA PAAD -0.185; TCGA PRAD -0.061; TCGA STAD -0.051
hsa-miR-429
WDR17
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.28; TCGA BRCA -0.251; TCGA COAD -0.638; TCGA ESCA -0.601; TCGA HNSC -0.176; TCGA LUSC -0.521; TCGA OV -0.178; TCGA STAD -0.56; TCGA UCEC -0.541
hsa-miR-429
HTR2B
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.113; TCGA BRCA -0.245; TCGA COAD -1.015; TCGA ESCA -0.154; TCGA HNSC -0.161; TCGA LUSC -0.192; TCGA PAAD -0.227; TCGA STAD -0.34; TCGA UCEC -0.288
hsa-miR-429
MEOX2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.597; TCGA BRCA -0.54; TCGA CESC -0.424; TCGA COAD -1.223; TCGA ESCA -0.421; TCGA HNSC -0.517; TCGA KIRC -0.38; TCGA LIHC -0.174; TCGA LUAD -0.164; TCGA LUSC -0.624; TCGA OV -0.401; TCGA PAAD -0.494; TCGA PRAD -0.218; TCGA STAD -0.477; TCGA UCEC -0.59
hsa-miR-429
ANKS1B
9 cancers: BLCA; ESCA; KIRC; LUSC; OV; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.389; TCGA ESCA -0.424; TCGA KIRC -0.084; TCGA LUSC -0.361; TCGA OV -0.176; TCGA PRAD -0.065; TCGA THCA -0.07; TCGA STAD -0.134; TCGA UCEC -0.173
hsa-miR-429
CD109
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.507; TCGA BRCA -0.137; TCGA CESC -0.49; TCGA COAD -0.721; TCGA ESCA -0.415; TCGA KIRC -0.311; TCGA LIHC -0.128; TCGA LUAD -0.357; TCGA PAAD -0.192; TCGA PRAD -0.057; TCGA STAD -0.307; TCGA UCEC -0.2
hsa-miR-429
MED13L
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.061; TCGA BRCA -0.076; TCGA CESC -0.093; TCGA ESCA -0.078; TCGA HNSC -0.121; TCGA KIRC -0.103; TCGA PAAD -0.134; TCGA STAD -0.11; TCGA UCEC -0.133
hsa-miR-429
TMEM170B
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.239; TCGA COAD -0.165; TCGA HNSC -0.185; TCGA KIRP -0.111; TCGA LIHC -0.118; TCGA LUSC -0.12; TCGA OV -0.066; TCGA PAAD -0.193; TCGA STAD -0.27; TCGA UCEC -0.179
hsa-miR-429
GHR
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.353; TCGA BRCA -0.565; TCGA CESC -0.243; TCGA COAD -0.386; TCGA ESCA -0.371; TCGA HNSC -0.219; TCGA LUAD -0.197; TCGA OV -0.249; TCGA PAAD -0.351; TCGA THCA -0.078; TCGA STAD -0.498; TCGA UCEC -0.439
hsa-miR-429
GAB1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.114; TCGA CESC -0.091; TCGA ESCA -0.145; TCGA HNSC -0.158; TCGA LUAD -0.102; TCGA LUSC -0.138; TCGA OV -0.068; TCGA PAAD -0.093; TCGA STAD -0.193; TCGA UCEC -0.177
hsa-miR-429
ERG
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.201; TCGA BRCA -0.338; TCGA CESC -0.355; TCGA COAD -0.491; TCGA ESCA -0.203; TCGA HNSC -0.275; TCGA KIRC -0.127; TCGA LUAD -0.193; TCGA LUSC -0.313; TCGA PAAD -0.363; TCGA STAD -0.2; TCGA UCEC -0.209
hsa-miR-429
SLC2A3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.353; TCGA BRCA -0.2; TCGA CESC -0.21; TCGA COAD -0.449; TCGA ESCA -0.237; TCGA HNSC -0.306; TCGA KIRC -0.568; TCGA LUAD -0.348; TCGA LUSC -0.507; TCGA PAAD -0.261; TCGA PRAD -0.134; TCGA STAD -0.096; TCGA UCEC -0.168
hsa-miR-429
LRRK2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.426; TCGA BRCA -0.293; TCGA CESC -0.294; TCGA COAD -0.746; TCGA ESCA -0.439; TCGA HNSC -0.282; TCGA LUAD -0.202; TCGA LUSC -0.478; TCGA PAAD -0.518; TCGA PRAD -0.123; TCGA STAD -0.396; TCGA UCEC -0.428
hsa-miR-429
GPR183
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.442; TCGA BRCA -0.11; TCGA CESC -0.251; TCGA COAD -0.531; TCGA ESCA -0.262; TCGA HNSC -0.329; TCGA KIRC -0.387; TCGA KIRP -0.169; TCGA LUAD -0.181; TCGA LUSC -0.517; TCGA PAAD -0.547; TCGA PRAD -0.078; TCGA STAD -0.21; TCGA UCEC -0.089
hsa-miR-429
STAC
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.45; TCGA BRCA -0.244; TCGA CESC -0.305; TCGA COAD -0.727; TCGA ESCA -0.485; TCGA HNSC -0.41; TCGA LUAD -0.321; TCGA LUSC -0.502; TCGA OV -0.259; TCGA PAAD -0.215; TCGA PRAD -0.199; TCGA STAD -0.518; TCGA UCEC -0.224
hsa-miR-429
PTPN22
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.342; TCGA CESC -0.16; TCGA COAD -0.167; TCGA HNSC -0.278; TCGA KIRC -0.462; TCGA KIRP -0.216; TCGA LUAD -0.258; TCGA LUSC -0.538; TCGA PAAD -0.362
hsa-miR-429
FBXO30
10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.115; TCGA COAD -0.065; TCGA ESCA -0.127; TCGA HNSC -0.119; TCGA KIRP -0.109; TCGA LUAD -0.092; TCGA PAAD -0.154; TCGA PRAD -0.075; TCGA STAD -0.214; TCGA UCEC -0.143
hsa-miR-429
PCDH9
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.485; TCGA BRCA -0.553; TCGA COAD -0.763; TCGA ESCA -0.651; TCGA HNSC -0.441; TCGA LUAD -0.217; TCGA LUSC -0.505; TCGA OV -0.329; TCGA PAAD -0.437; TCGA PRAD -0.072; TCGA STAD -0.66; TCGA UCEC -0.238
hsa-miR-429
COL5A3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.315; TCGA BRCA -0.143; TCGA CESC -0.416; TCGA COAD -0.331; TCGA ESCA -0.238; TCGA HNSC -0.377; TCGA KIRC -0.931; TCGA KIRP -0.326; TCGA LIHC -0.264; TCGA LUAD -0.237; TCGA LUSC -0.269; TCGA PAAD -0.169; TCGA PRAD -0.113; TCGA UCEC -0.178
hsa-miR-429
LRCH2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.305; TCGA BRCA -0.356; TCGA CESC -0.367; TCGA COAD -0.767; TCGA ESCA -0.405; TCGA HNSC -0.443; TCGA KIRP -0.281; TCGA LUAD -0.226; TCGA LUSC -0.509; TCGA OV -0.275; TCGA PAAD -0.273; TCGA PRAD -0.159; TCGA STAD -0.412; TCGA UCEC -0.46
hsa-miR-429
NOD1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.054; TCGA BRCA -0.101; TCGA CESC -0.094; TCGA ESCA -0.114; TCGA HNSC -0.089; TCGA KIRC -0.176; TCGA LUSC -0.159; TCGA PAAD -0.154; TCGA STAD -0.133; TCGA UCEC -0.053
hsa-miR-429
S1PR3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.257; TCGA BRCA -0.088; TCGA CESC -0.393; TCGA COAD -0.476; TCGA ESCA -0.488; TCGA HNSC -0.448; TCGA KIRC -0.086; TCGA LUAD -0.157; TCGA LUSC -0.293; TCGA PAAD -0.39; TCGA PRAD -0.128; TCGA STAD -0.426; TCGA UCEC -0.219
hsa-miR-429
RHOBTB1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.07; TCGA BRCA -0.082; TCGA COAD -0.116; TCGA HNSC -0.312; TCGA KIRC -0.175; TCGA KIRP -0.236; TCGA LUSC -0.211; TCGA PAAD -0.093; TCGA PRAD -0.079; TCGA UCEC -0.07
hsa-miR-429
GPR82
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.267; TCGA CESC -0.254; TCGA COAD -0.19; TCGA HNSC -0.224; TCGA KIRC -0.421; TCGA KIRP -0.302; TCGA LUAD -0.112; TCGA LUSC -0.222; TCGA PAAD -0.367
hsa-miR-429
TNFSF4
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.303; TCGA CESC -0.206; TCGA COAD -0.568; TCGA ESCA -0.2; TCGA HNSC -0.239; TCGA KIRC -0.2; TCGA KIRP -0.133; TCGA LUAD -0.196; TCGA LUSC -0.255; TCGA OV -0.171; TCGA PAAD -0.297; TCGA STAD -0.131; TCGA UCEC -0.077
hsa-miR-429
PDZD2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.179; TCGA BRCA -0.428; TCGA CESC -0.191; TCGA COAD -0.28; TCGA ESCA -0.194; TCGA HNSC -0.175; TCGA LUSC -0.217; TCGA STAD -0.261; TCGA UCEC -0.179
hsa-miR-429
SGCB
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.26; TCGA BRCA -0.167; TCGA COAD -0.125; TCGA ESCA -0.127; TCGA HNSC -0.254; TCGA KIRC -0.117; TCGA KIRP -0.124; TCGA LUAD -0.117; TCGA LUSC -0.173; TCGA OV -0.074; TCGA PAAD -0.064; TCGA PRAD -0.079; TCGA STAD -0.17; TCGA UCEC -0.067
hsa-miR-429
HSPB8
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.269; TCGA BRCA -0.272; TCGA CESC -0.34; TCGA COAD -0.928; TCGA ESCA -0.533; TCGA HNSC -0.223; TCGA KIRC -0.3; TCGA KIRP -0.406; TCGA LUAD -0.116; TCGA LUSC -0.27; TCGA PAAD -0.331; TCGA PRAD -0.107; TCGA THCA -0.094; TCGA STAD -0.687; TCGA UCEC -0.312
hsa-miR-429
MTMR9
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.137; TCGA CESC -0.086; TCGA COAD -0.162; TCGA HNSC -0.079; TCGA LUAD -0.069; TCGA LUSC -0.053; TCGA OV -0.06; TCGA PAAD -0.134; TCGA PRAD -0.095; TCGA STAD -0.114; TCGA UCEC -0.123
hsa-miR-429
PDK4
11 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.234; TCGA BRCA -0.567; TCGA COAD -0.393; TCGA HNSC -0.587; TCGA LIHC -0.159; TCGA LUAD -0.205; TCGA LUSC -0.591; TCGA OV -0.12; TCGA PAAD -0.173; TCGA STAD -0.531; TCGA UCEC -0.345
hsa-miR-429
PRKCA
11 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.108; TCGA BRCA -0.302; TCGA HNSC -0.267; TCGA LIHC -0.055; TCGA LUAD -0.143; TCGA LUSC -0.297; TCGA PAAD -0.074; TCGA PRAD -0.1; TCGA THCA -0.086; TCGA STAD -0.101; TCGA UCEC -0.269
hsa-miR-429
SNRK
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.06; TCGA BRCA -0.168; TCGA CESC -0.086; TCGA COAD -0.115; TCGA ESCA -0.063; TCGA HNSC -0.131; TCGA LUAD -0.106; TCGA LUSC -0.228; TCGA PAAD -0.122; TCGA STAD -0.119; TCGA UCEC -0.14
hsa-miR-429
TRIM22
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.233; TCGA BRCA -0.147; TCGA CESC -0.283; TCGA COAD -0.404; TCGA ESCA -0.297; TCGA HNSC -0.236; TCGA KIRC -0.219; TCGA LUAD -0.084; TCGA LUSC -0.374; TCGA PAAD -0.347; TCGA STAD -0.163; TCGA UCEC -0.071
hsa-miR-429
HAND2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.464; TCGA BRCA -0.277; TCGA CESC -0.473; TCGA COAD -1.332; TCGA ESCA -0.836; TCGA HNSC -0.34; TCGA PAAD -0.201; TCGA STAD -0.891; TCGA UCEC -0.535
hsa-miR-429
RAB39B
9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.122; TCGA COAD -0.434; TCGA ESCA -0.189; TCGA HNSC -0.11; TCGA LUAD -0.093; TCGA LUSC -0.246; TCGA PAAD -0.369; TCGA STAD -0.183; TCGA UCEC -0.083
hsa-miR-429
ADAM19
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.441; TCGA CESC -0.253; TCGA COAD -0.303; TCGA ESCA -0.269; TCGA HNSC -0.368; TCGA KIRC -0.44; TCGA LUAD -0.156; TCGA LUSC -0.374; TCGA PAAD -0.319; TCGA PRAD -0.065; TCGA STAD -0.189; TCGA UCEC -0.067
hsa-miR-429
CCDC102B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.158; TCGA BRCA -0.123; TCGA CESC -0.154; TCGA COAD -0.326; TCGA ESCA -0.158; TCGA HNSC -0.196; TCGA KIRC -0.337; TCGA KIRP -0.085; TCGA LUAD -0.203; TCGA LUSC -0.326; TCGA OV -0.094; TCGA PAAD -0.297; TCGA STAD -0.096; TCGA UCEC -0.206
hsa-miR-429
PCBP3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.32; TCGA BRCA -0.271; TCGA CESC -0.382; TCGA COAD -0.481; TCGA ESCA -0.542; TCGA HNSC -0.119; TCGA LUSC -0.207; TCGA PAAD -0.369; TCGA STAD -0.356; TCGA UCEC -0.419
hsa-miR-429
IRF8
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.431; TCGA BRCA -0.123; TCGA CESC -0.208; TCGA HNSC -0.346; TCGA KIRC -0.157; TCGA KIRP -0.236; TCGA LUAD -0.203; TCGA LUSC -0.583; TCGA PAAD -0.402; TCGA UCEC -0.13
hsa-miR-429
PALM2-AKAP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.365; TCGA BRCA -0.335; TCGA CESC -0.339; TCGA COAD -0.38; TCGA ESCA -0.193; TCGA HNSC -0.342; TCGA KIRC -0.125; TCGA KIRP -0.091; TCGA LUAD -0.251; TCGA LUSC -0.541; TCGA OV -0.096; TCGA PAAD -0.315; TCGA STAD -0.239; TCGA UCEC -0.299
hsa-miR-429
NLRC3
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.233; TCGA CESC -0.185; TCGA COAD -0.187; TCGA HNSC -0.096; TCGA KIRC -0.222; TCGA LUAD -0.088; TCGA LUSC -0.35; TCGA PAAD -0.349; TCGA STAD -0.098; TCGA UCEC -0.085
hsa-miR-429
TTLL7
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; STAD
miRanda
TCGA BLCA -0.272; TCGA BRCA -0.167; TCGA COAD -0.522; TCGA ESCA -0.216; TCGA HNSC -0.224; TCGA KIRC -0.227; TCGA KIRP -0.185; TCGA LIHC -0.221; TCGA LUSC -0.19; TCGA THCA -0.084; TCGA STAD -0.419
hsa-miR-429
IRAK3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.227; TCGA BRCA -0.335; TCGA CESC -0.177; TCGA COAD -0.426; TCGA HNSC -0.123; TCGA KIRC -0.203; TCGA LUAD -0.094; TCGA LUSC -0.273; TCGA PAAD -0.202; TCGA PRAD -0.086; TCGA STAD -0.106; TCGA UCEC -0.257
hsa-miR-429
ELK3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.172; TCGA BRCA -0.223; TCGA CESC -0.308; TCGA COAD -0.382; TCGA ESCA -0.145; TCGA HNSC -0.293; TCGA KIRC -0.21; TCGA LUAD -0.259; TCGA LUSC -0.263; TCGA OV -0.079; TCGA PAAD -0.226; TCGA PRAD -0.085; TCGA STAD -0.138; TCGA UCEC -0.241
hsa-miR-429
ITGAV
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.127; TCGA BRCA -0.105; TCGA CESC -0.128; TCGA COAD -0.24; TCGA ESCA -0.128; TCGA HNSC -0.159; TCGA KIRP -0.222; TCGA LUAD -0.131; TCGA LUSC -0.063; TCGA PAAD -0.122; TCGA STAD -0.1; TCGA UCEC -0.137
hsa-miR-429
CYR61
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.39; TCGA BRCA -0.284; TCGA CESC -0.284; TCGA COAD -0.543; TCGA ESCA -0.344; TCGA HNSC -0.312; TCGA LUAD -0.182; TCGA LUSC -0.46; TCGA OV -0.149; TCGA PAAD -0.379; TCGA PRAD -0.106; TCGA STAD -0.223; TCGA UCEC -0.278
hsa-miR-429
SNX3
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.065; TCGA BRCA -0.058; TCGA ESCA -0.057; TCGA HNSC -0.085; TCGA KIRC -0.066; TCGA KIRP -0.177; TCGA LUAD -0.119; TCGA PAAD -0.119; TCGA STAD -0.061; TCGA UCEC -0.067
hsa-miR-429
SV2B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.43; TCGA BRCA -0.419; TCGA CESC -0.403; TCGA COAD -0.939; TCGA ESCA -0.476; TCGA HNSC -0.306; TCGA KIRP -0.479; TCGA LUAD -0.206; TCGA OV -0.206; TCGA PAAD -0.238; TCGA PRAD -0.091; TCGA STAD -0.364; TCGA UCEC -0.347
hsa-miR-429
KLHDC8B
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.07; TCGA CESC -0.156; TCGA COAD -0.277; TCGA ESCA -0.234; TCGA PAAD -0.114; TCGA PRAD -0.06; TCGA STAD -0.247; TCGA UCEC -0.135
hsa-miR-429
SOD2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA
miRanda
TCGA BLCA -0.264; TCGA BRCA -0.11; TCGA CESC -0.207; TCGA COAD -0.079; TCGA ESCA -0.14; TCGA HNSC -0.122; TCGA KIRC -0.197; TCGA KIRP -0.427; TCGA LIHC -0.072; TCGA LUAD -0.218; TCGA LUSC -0.22; TCGA PAAD -0.169; TCGA THCA -0.055
hsa-miR-429
CYBRD1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.4; TCGA BRCA -0.308; TCGA CESC -0.213; TCGA COAD -0.616; TCGA ESCA -0.333; TCGA HNSC -0.26; TCGA KIRP -0.305; TCGA LUAD -0.213; TCGA LUSC -0.423; TCGA OV -0.107; TCGA PAAD -0.304; TCGA STAD -0.339; TCGA UCEC -0.377
hsa-miR-429
CHSY1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.097; TCGA CESC -0.128; TCGA COAD -0.169; TCGA ESCA -0.112; TCGA HNSC -0.178; TCGA KIRC -0.167; TCGA LUAD -0.115; TCGA OV -0.059; TCGA PAAD -0.239; TCGA STAD -0.058; TCGA UCEC -0.082
hsa-miR-429
CYLD
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.056; TCGA CESC -0.122; TCGA COAD -0.12; TCGA ESCA -0.177; TCGA HNSC -0.167; TCGA KIRC -0.07; TCGA KIRP -0.094; TCGA LUAD -0.078; TCGA LUSC -0.235; TCGA PAAD -0.134; TCGA STAD -0.119; TCGA UCEC -0.081
hsa-miR-429
CHST7
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.207; TCGA BRCA -0.197; TCGA COAD -0.258; TCGA ESCA -0.225; TCGA KIRC -0.158; TCGA LUAD -0.075; TCGA PAAD -0.179; TCGA STAD -0.154; TCGA UCEC -0.166
hsa-miR-429
NMT2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.243; TCGA BRCA -0.269; TCGA CESC -0.147; TCGA HNSC -0.07; TCGA KIRP -0.161; TCGA LIHC -0.067; TCGA LUAD -0.076; TCGA LUSC -0.07; TCGA STAD -0.063; TCGA UCEC -0.191
hsa-miR-429
ROR1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.49; TCGA BRCA -0.358; TCGA CESC -0.36; TCGA COAD -0.608; TCGA HNSC -0.58; TCGA KIRC -0.105; TCGA LUAD -0.226; TCGA LUSC -0.743; TCGA OV -0.175; TCGA PAAD -0.211; TCGA PRAD -0.103; TCGA STAD -0.238; TCGA UCEC -0.246
hsa-miR-429
CXCL9
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.421; TCGA CESC -0.425; TCGA COAD -0.524; TCGA ESCA -0.198; TCGA HNSC -0.417; TCGA KIRC -0.601; TCGA KIRP -0.426; TCGA LUAD -0.285; TCGA LUSC -0.456; TCGA PAAD -0.566
hsa-miR-429
PGM5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.49; TCGA BRCA -0.537; TCGA CESC -0.321; TCGA COAD -0.827; TCGA ESCA -0.53; TCGA HNSC -0.458; TCGA LUAD -0.129; TCGA LUSC -0.655; TCGA PAAD -0.356; TCGA PRAD -0.118; TCGA STAD -0.772; TCGA UCEC -0.596
hsa-miR-429
TTBK2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.266; TCGA CESC -0.135; TCGA COAD -0.253; TCGA ESCA -0.192; TCGA HNSC -0.158; TCGA LUAD -0.11; TCGA LUSC -0.066; TCGA PAAD -0.183; TCGA PRAD -0.09; TCGA STAD -0.218; TCGA UCEC -0.159
hsa-miR-429
SUSD5
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.32; TCGA BRCA -0.186; TCGA CESC -0.269; TCGA COAD -0.805; TCGA ESCA -0.318; TCGA HNSC -0.538; TCGA KIRP -0.178; TCGA LUAD -0.114; TCGA LUSC -0.55; TCGA OV -0.245; TCGA PAAD -0.403; TCGA PRAD -0.085; TCGA THCA -0.06; TCGA STAD -0.467; TCGA UCEC -0.307
hsa-miR-429
COL4A1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.118; TCGA CESC -0.248; TCGA COAD -0.293; TCGA ESCA -0.092; TCGA HNSC -0.27; TCGA KIRC -0.472; TCGA KIRP -0.139; TCGA LUAD -0.195; TCGA LUSC -0.205; TCGA PAAD -0.206; TCGA PRAD -0.134; TCGA STAD -0.108
hsa-miR-429
ADAP2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.231; TCGA BRCA -0.06; TCGA CESC -0.261; TCGA COAD -0.276; TCGA ESCA -0.168; TCGA HNSC -0.199; TCGA KIRC -0.383; TCGA KIRP -0.296; TCGA LUAD -0.183; TCGA LUSC -0.378; TCGA PAAD -0.31; TCGA PRAD -0.077; TCGA STAD -0.063
hsa-miR-429
PLA2G5
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.492; TCGA BRCA -0.334; TCGA COAD -0.865; TCGA ESCA -0.548; TCGA HNSC -0.29; TCGA KIRC -0.668; TCGA LUAD -0.178; TCGA LUSC -0.466; TCGA OV -0.265; TCGA PAAD -0.397; TCGA STAD -0.494; TCGA UCEC -0.298
hsa-miR-429
AKAP6
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.391; TCGA BRCA -0.297; TCGA COAD -0.318; TCGA ESCA -0.345; TCGA HNSC -0.521; TCGA LIHC -0.121; TCGA LUSC -0.266; TCGA PAAD -0.194; TCGA PRAD -0.109; TCGA STAD -0.648; TCGA UCEC -0.131
hsa-miR-429
KDELC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.054; TCGA CESC -0.192; TCGA COAD -0.255; TCGA ESCA -0.136; TCGA HNSC -0.162; TCGA KIRC -0.262; TCGA KIRP -0.316; TCGA LUAD -0.184; TCGA LUSC -0.125; TCGA OV -0.118; TCGA PAAD -0.231; TCGA STAD -0.061; TCGA UCEC -0.19
hsa-miR-429
CDC42EP3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.214; TCGA BRCA -0.141; TCGA CESC -0.205; TCGA COAD -0.289; TCGA ESCA -0.306; TCGA HNSC -0.28; TCGA LUAD -0.089; TCGA LUSC -0.199; TCGA OV -0.064; TCGA PAAD -0.089; TCGA PRAD -0.112; TCGA STAD -0.316; TCGA UCEC -0.243
hsa-miR-429
SIRPB1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.317; TCGA BRCA -0.186; TCGA CESC -0.391; TCGA COAD -0.405; TCGA ESCA -0.269; TCGA HNSC -0.394; TCGA KIRC -0.34; TCGA KIRP -0.372; TCGA LUAD -0.383; TCGA LUSC -0.561; TCGA PAAD -0.373; TCGA PRAD -0.068; TCGA THCA -0.057; TCGA UCEC -0.1
hsa-miR-429
SLC6A15
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; OV; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.426; TCGA BRCA -0.268; TCGA CESC -0.39; TCGA ESCA -0.692; TCGA HNSC -0.217; TCGA KIRP -0.754; TCGA OV -0.475; TCGA STAD -0.598; TCGA UCEC -0.4
hsa-miR-429
ASPN
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.317; TCGA BRCA -0.136; TCGA CESC -0.373; TCGA COAD -0.9; TCGA ESCA -0.217; TCGA HNSC -0.498; TCGA LUAD -0.138; TCGA LUSC -0.428; TCGA OV -0.319; TCGA PAAD -0.305; TCGA STAD -0.353; TCGA UCEC -0.473
hsa-miR-429
KLF6
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.111; TCGA BRCA -0.186; TCGA CESC -0.215; TCGA COAD -0.083; TCGA ESCA -0.092; TCGA HNSC -0.205; TCGA KIRC -0.133; TCGA LUAD -0.177; TCGA LUSC -0.389; TCGA STAD -0.055; TCGA UCEC -0.182
hsa-miR-429
NRP1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.248; TCGA BRCA -0.264; TCGA CESC -0.239; TCGA COAD -0.462; TCGA ESCA -0.175; TCGA HNSC -0.367; TCGA KIRC -0.267; TCGA LUAD -0.184; TCGA LUSC -0.377; TCGA PAAD -0.186; TCGA STAD -0.151; TCGA UCEC -0.162
hsa-miR-429
TACR1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.229; TCGA BRCA -0.517; TCGA COAD -0.922; TCGA ESCA -0.344; TCGA HNSC -0.284; TCGA LUAD -0.162; TCGA LUSC -0.343; TCGA PAAD -0.302; TCGA PRAD -0.074; TCGA STAD -0.462; TCGA UCEC -0.252
hsa-miR-429
HLA-DQA1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.399; TCGA CESC -0.271; TCGA COAD -0.597; TCGA ESCA -0.2; TCGA HNSC -0.303; TCGA KIRC -0.374; TCGA KIRP -0.256; TCGA LUAD -0.212; TCGA LUSC -0.613; TCGA PAAD -0.517; TCGA PRAD -0.075
hsa-miR-429
DOCK10
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.365; TCGA BRCA -0.066; TCGA CESC -0.236; TCGA COAD -0.464; TCGA ESCA -0.237; TCGA HNSC -0.354; TCGA KIRC -0.336; TCGA KIRP -0.237; TCGA LUAD -0.193; TCGA LUSC -0.504; TCGA PAAD -0.4; TCGA STAD -0.103; TCGA UCEC -0.187
hsa-miR-429
ELOVL5
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.128; TCGA BRCA -0.1; TCGA CESC -0.073; TCGA COAD -0.12; TCGA ESCA -0.385; TCGA HNSC -0.053; TCGA KIRC -0.203; TCGA KIRP -0.319; TCGA LIHC -0.091; TCGA PAAD -0.165; TCGA STAD -0.181
hsa-miR-429
DNAJC24
9 cancers: BLCA; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.08; TCGA ESCA -0.062; TCGA HNSC -0.085; TCGA KIRP -0.056; TCGA LUAD -0.057; TCGA PAAD -0.053; TCGA PRAD -0.059; TCGA STAD -0.096; TCGA UCEC -0.071
hsa-miR-429
FERMT2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.411; TCGA BRCA -0.348; TCGA CESC -0.256; TCGA COAD -0.684; TCGA ESCA -0.406; TCGA HNSC -0.371; TCGA LUAD -0.236; TCGA LUSC -0.445; TCGA OV -0.105; TCGA PAAD -0.336; TCGA PRAD -0.153; TCGA STAD -0.481; TCGA UCEC -0.277
hsa-miR-429
TNFAIP3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.25; TCGA BRCA -0.102; TCGA CESC -0.216; TCGA COAD -0.132; TCGA ESCA -0.13; TCGA HNSC -0.085; TCGA KIRC -0.31; TCGA KIRP -0.129; TCGA LUAD -0.241; TCGA LUSC -0.252; TCGA PAAD -0.268; TCGA STAD -0.058
hsa-miR-429
CASQ2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.723; TCGA BRCA -0.574; TCGA CESC -0.279; TCGA COAD -1.503; TCGA ESCA -0.704; TCGA HNSC -0.93; TCGA LIHC -0.102; TCGA LUSC -0.583; TCGA PAAD -0.475; TCGA PRAD -0.25; TCGA STAD -0.939; TCGA UCEC -0.424
hsa-miR-429
CPE
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.224; TCGA BRCA -0.265; TCGA CESC -0.301; TCGA COAD -0.523; TCGA ESCA -0.464; TCGA KIRC -0.215; TCGA LUAD -0.129; TCGA PRAD -0.117; TCGA STAD -0.43; TCGA UCEC -0.292
hsa-miR-429
FOXN2
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.053; TCGA BRCA -0.175; TCGA HNSC -0.096; TCGA KIRC -0.133; TCGA KIRP -0.077; TCGA LUAD -0.141; TCGA LUSC -0.109; TCGA PAAD -0.11; TCGA UCEC -0.07
hsa-miR-429
SOAT1
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda; miRNATAP
TCGA BLCA -0.128; TCGA COAD -0.228; TCGA ESCA -0.123; TCGA HNSC -0.126; TCGA KIRC -0.073; TCGA KIRP -0.289; TCGA LUAD -0.086; TCGA LUSC -0.214; TCGA PAAD -0.103
hsa-miR-429
PJA2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.165; TCGA BRCA -0.147; TCGA CESC -0.104; TCGA COAD -0.129; TCGA ESCA -0.178; TCGA HNSC -0.162; TCGA KIRP -0.135; TCGA LIHC -0.062; TCGA LUAD -0.102; TCGA LUSC -0.183; TCGA OV -0.05; TCGA PAAD -0.093; TCGA PRAD -0.078; TCGA STAD -0.227; TCGA UCEC -0.183
hsa-miR-429
ABCA9
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.693; TCGA CESC -0.301; TCGA COAD -0.767; TCGA ESCA -0.446; TCGA HNSC -0.362; TCGA LIHC -0.096; TCGA LUAD -0.168; TCGA LUSC -0.503; TCGA PAAD -0.366; TCGA PRAD -0.077; TCGA STAD -0.559; TCGA UCEC -0.402
hsa-miR-429
STEAP4
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.271; TCGA BRCA -0.34; TCGA CESC -0.355; TCGA COAD -0.7; TCGA ESCA -0.246; TCGA HNSC -0.162; TCGA KIRC -0.226; TCGA LUSC -0.477; TCGA STAD -0.352; TCGA UCEC -0.245
hsa-miR-429
CYTIP
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.351; TCGA CESC -0.28; TCGA COAD -0.301; TCGA HNSC -0.199; TCGA KIRC -0.303; TCGA KIRP -0.195; TCGA LUAD -0.181; TCGA LUSC -0.494; TCGA PAAD -0.453
hsa-miR-429
KCTD12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.332; TCGA BRCA -0.314; TCGA CESC -0.28; TCGA COAD -0.471; TCGA ESCA -0.218; TCGA HNSC -0.351; TCGA LUAD -0.176; TCGA LUSC -0.421; TCGA PAAD -0.211; TCGA PRAD -0.052; TCGA STAD -0.203; TCGA UCEC -0.416
hsa-miR-429
CSGALNACT2
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.146; TCGA CESC -0.166; TCGA COAD -0.274; TCGA ESCA -0.16; TCGA HNSC -0.218; TCGA KIRC -0.209; TCGA KIRP -0.082; TCGA LUAD -0.13; TCGA LUSC -0.238; TCGA PAAD -0.204; TCGA PRAD -0.065; TCGA STAD -0.133; TCGA UCEC -0.121
hsa-miR-429
RECQL
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.113; TCGA BRCA -0.066; TCGA CESC -0.089; TCGA COAD -0.179; TCGA ESCA -0.131; TCGA HNSC -0.085; TCGA KIRC -0.202; TCGA KIRP -0.125; TCGA LUAD -0.158; TCGA PAAD -0.169; TCGA PRAD -0.058; TCGA UCEC -0.125
hsa-miR-429
MAP4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.12; TCGA BRCA -0.098; TCGA CESC -0.127; TCGA COAD -0.076; TCGA ESCA -0.148; TCGA HNSC -0.289; TCGA KIRP -0.061; TCGA LUAD -0.131; TCGA LUSC -0.183; TCGA PAAD -0.065; TCGA PRAD -0.062; TCGA STAD -0.151; TCGA UCEC -0.079
hsa-miR-429
MAMLD1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.324; TCGA BRCA -0.149; TCGA CESC -0.172; TCGA COAD -0.34; TCGA ESCA -0.256; TCGA KIRC -0.077; TCGA LUAD -0.221; TCGA LUSC -0.093; TCGA OV -0.137; TCGA PRAD -0.123; TCGA STAD -0.212; TCGA UCEC -0.212
hsa-miR-429
NRK
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.177; TCGA BRCA -0.252; TCGA CESC -0.281; TCGA COAD -0.972; TCGA ESCA -0.586; TCGA HNSC -0.524; TCGA LUAD -0.241; TCGA PAAD -0.436; TCGA PRAD -0.187; TCGA STAD -0.666; TCGA UCEC -0.493
hsa-miR-429
SYNE1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.268; TCGA BRCA -0.323; TCGA CESC -0.343; TCGA COAD -0.568; TCGA ESCA -0.314; TCGA HNSC -0.447; TCGA LUAD -0.08; TCGA LUSC -0.58; TCGA PAAD -0.273; TCGA STAD -0.408; TCGA UCEC -0.416
hsa-miR-429
CCDC85A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.101; TCGA BRCA -0.398; TCGA CESC -0.29; TCGA COAD -0.494; TCGA ESCA -0.19; TCGA HNSC -0.304; TCGA KIRC -0.198; TCGA LUAD -0.16; TCGA LUSC -0.339; TCGA PAAD -0.129; TCGA PRAD -0.113; TCGA STAD -0.281; TCGA UCEC -0.373
hsa-miR-429
SCN3B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.359; TCGA BRCA -0.505; TCGA CESC -0.335; TCGA COAD -0.736; TCGA ESCA -0.354; TCGA HNSC -0.391; TCGA KIRP -0.255; TCGA LUAD -0.281; TCGA LUSC -0.263; TCGA THCA -0.052; TCGA STAD -0.373; TCGA UCEC -0.442
hsa-miR-429
KCNMA1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.485; TCGA BRCA -0.219; TCGA CESC -0.387; TCGA COAD -0.921; TCGA ESCA -0.754; TCGA HNSC -0.313; TCGA KIRC -0.36; TCGA LUAD -0.246; TCGA LUSC -0.422; TCGA PAAD -0.233; TCGA PRAD -0.17; TCGA THCA -0.093; TCGA STAD -0.777; TCGA UCEC -0.452
hsa-miR-429
STK10
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.111; TCGA BRCA -0.053; TCGA CESC -0.163; TCGA COAD -0.076; TCGA HNSC -0.147; TCGA KIRC -0.263; TCGA KIRP -0.134; TCGA LUAD -0.182; TCGA LUSC -0.364; TCGA PAAD -0.1
hsa-miR-429
PPTC7
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.071; TCGA BRCA -0.167; TCGA ESCA -0.076; TCGA HNSC -0.11; TCGA LUAD -0.127; TCGA PRAD -0.101; TCGA THCA -0.061; TCGA STAD -0.055; TCGA UCEC -0.129
hsa-miR-429
GNG2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.332; TCGA BRCA -0.367; TCGA CESC -0.298; TCGA COAD -0.374; TCGA ESCA -0.192; TCGA HNSC -0.327; TCGA KIRC -0.254; TCGA LUAD -0.204; TCGA LUSC -0.418; TCGA PAAD -0.323; TCGA PRAD -0.123; TCGA STAD -0.216; TCGA UCEC -0.267
hsa-miR-429
MID2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.094; TCGA BRCA -0.129; TCGA CESC -0.133; TCGA COAD -0.317; TCGA ESCA -0.277; TCGA LIHC -0.071; TCGA LUAD -0.06; TCGA PAAD -0.097; TCGA STAD -0.369; TCGA UCEC -0.185
hsa-miR-429
ST6GALNAC3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.201; TCGA BRCA -0.324; TCGA CESC -0.303; TCGA COAD -0.141; TCGA HNSC -0.266; TCGA LUAD -0.151; TCGA LUSC -0.357; TCGA OV -0.12; TCGA PAAD -0.206; TCGA PRAD -0.131; TCGA STAD -0.171; TCGA UCEC -0.343
hsa-miR-429
NUDT11
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.331; TCGA BRCA -0.22; TCGA CESC -0.303; TCGA COAD -0.614; TCGA ESCA -0.523; TCGA KIRP -0.434; TCGA LUAD -0.248; TCGA OV -0.262; TCGA PAAD -0.252; TCGA STAD -0.441; TCGA UCEC -0.47
hsa-miR-429
GPRIN3
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
miRanda
TCGA BLCA -0.23; TCGA BRCA -0.111; TCGA CESC -0.174; TCGA HNSC -0.433; TCGA KIRP -0.295; TCGA LUAD -0.232; TCGA LUSC -0.591; TCGA PAAD -0.141; TCGA PRAD -0.087; TCGA THCA -0.069
hsa-miR-429
CD274
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.342; TCGA BRCA -0.101; TCGA CESC -0.415; TCGA COAD -0.367; TCGA ESCA -0.202; TCGA HNSC -0.38; TCGA KIRP -0.504; TCGA LUAD -0.444; TCGA LUSC -0.4; TCGA PAAD -0.247; TCGA PRAD -0.066; TCGA THCA -0.082; TCGA UCEC -0.075
hsa-miR-429
IKBIP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.063; TCGA CESC -0.173; TCGA COAD -0.217; TCGA ESCA -0.142; TCGA HNSC -0.142; TCGA KIRC -0.396; TCGA KIRP -0.283; TCGA LUAD -0.215; TCGA LUSC -0.12; TCGA OV -0.094; TCGA PAAD -0.166; TCGA UCEC -0.154
hsa-miR-429
SLC16A1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.459; TCGA BRCA -0.056; TCGA CESC -0.309; TCGA HNSC -0.108; TCGA KIRC -0.473; TCGA KIRP -0.784; TCGA LIHC -0.177; TCGA LUAD -0.308; TCGA PRAD -0.133; TCGA THCA -0.065; TCGA UCEC -0.196
hsa-miR-429
TCEAL7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.308; TCGA BRCA -0.386; TCGA CESC -0.368; TCGA COAD -0.64; TCGA ESCA -0.358; TCGA HNSC -0.391; TCGA LUAD -0.166; TCGA LUSC -0.45; TCGA PAAD -0.272; TCGA PRAD -0.1; TCGA STAD -0.424; TCGA UCEC -0.466
hsa-miR-429
MYO9A
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.101; TCGA BRCA -0.21; TCGA COAD -0.153; TCGA ESCA -0.132; TCGA HNSC -0.189; TCGA LUAD -0.098; TCGA LUSC -0.146; TCGA PAAD -0.185; TCGA PRAD -0.089; TCGA STAD -0.21; TCGA UCEC -0.122
hsa-miR-429
ADH1B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.428; TCGA BRCA -1.078; TCGA CESC -0.315; TCGA COAD -1.207; TCGA ESCA -0.489; TCGA HNSC -0.539; TCGA LIHC -0.347; TCGA LUSC -0.771; TCGA OV -0.554; TCGA PAAD -0.52; TCGA PRAD -0.283; TCGA STAD -0.581; TCGA UCEC -0.692
hsa-miR-429
FAM65C
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.073; TCGA BRCA -0.125; TCGA CESC -0.331; TCGA COAD -0.267; TCGA ESCA -0.177; TCGA HNSC -0.154; TCGA PAAD -0.334; TCGA PRAD -0.065; TCGA STAD -0.133; TCGA UCEC -0.307
hsa-miR-429
HMOX1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
miRanda
TCGA BLCA -0.105; TCGA CESC -0.162; TCGA COAD -0.133; TCGA ESCA -0.16; TCGA HNSC -0.229; TCGA KIRC -0.536; TCGA KIRP -0.379; TCGA LUAD -0.175; TCGA LUSC -0.31; TCGA PAAD -0.324; TCGA PRAD -0.07; TCGA THCA -0.059
hsa-miR-429
BICD2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.081; TCGA BRCA -0.068; TCGA CESC -0.219; TCGA COAD -0.11; TCGA ESCA -0.251; TCGA LUAD -0.077; TCGA PAAD -0.188; TCGA STAD -0.163; TCGA UCEC -0.09
hsa-miR-429
GNG12
9 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.161; TCGA BRCA -0.171; TCGA CESC -0.175; TCGA HNSC -0.098; TCGA LIHC -0.073; TCGA LUAD -0.087; TCGA PRAD -0.057; TCGA STAD -0.089; TCGA UCEC -0.139
hsa-miR-429
P4HA3
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.4; TCGA CESC -0.235; TCGA COAD -0.822; TCGA ESCA -0.218; TCGA HNSC -0.369; TCGA KIRC -0.697; TCGA KIRP -0.416; TCGA LUAD -0.109; TCGA LUSC -0.205; TCGA PAAD -0.362; TCGA PRAD -0.186
hsa-miR-429
RPS6KA2
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.071; TCGA BRCA -0.191; TCGA CESC -0.139; TCGA COAD -0.206; TCGA HNSC -0.242; TCGA LUSC -0.313; TCGA PAAD -0.088; TCGA STAD -0.143; TCGA UCEC -0.117
hsa-miR-429
CD80
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.34; TCGA CESC -0.307; TCGA COAD -0.328; TCGA ESCA -0.149; TCGA HNSC -0.257; TCGA KIRC -0.536; TCGA KIRP -0.461; TCGA LUAD -0.276; TCGA LUSC -0.557; TCGA PAAD -0.383
hsa-miR-429
ABCB1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.115; TCGA BRCA -0.41; TCGA CESC -0.319; TCGA ESCA -0.151; TCGA HNSC -0.256; TCGA LIHC -0.208; TCGA LUAD -0.263; TCGA LUSC -0.576; TCGA PAAD -0.172; TCGA STAD -0.181; TCGA UCEC -0.291
hsa-miR-429
FIBIN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.487; TCGA BRCA -0.246; TCGA CESC -0.449; TCGA COAD -0.657; TCGA ESCA -0.438; TCGA HNSC -0.595; TCGA LUAD -0.377; TCGA LUSC -0.484; TCGA PAAD -0.512; TCGA PRAD -0.081; TCGA THCA -0.221; TCGA STAD -0.326; TCGA UCEC -0.363
hsa-miR-429
ADAMTS16
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.513; TCGA BRCA -0.28; TCGA CESC -0.296; TCGA COAD -1.03; TCGA ESCA -0.43; TCGA HNSC -0.629; TCGA LUAD -0.154; TCGA LUSC -0.457; TCGA PAAD -0.496; TCGA STAD -0.269; TCGA UCEC -0.243
hsa-miR-429
KLHL6
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.262; TCGA BRCA -0.055; TCGA CESC -0.262; TCGA COAD -0.472; TCGA ESCA -0.161; TCGA HNSC -0.19; TCGA KIRC -0.526; TCGA KIRP -0.231; TCGA LUAD -0.139; TCGA LUSC -0.518; TCGA PAAD -0.567
hsa-miR-429
SLC35F1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.279; TCGA COAD -0.368; TCGA ESCA -0.292; TCGA KIRC -0.111; TCGA KIRP -0.272; TCGA OV -0.25; TCGA PAAD -0.217; TCGA PRAD -0.23; TCGA STAD -0.42; TCGA UCEC -0.373
hsa-miR-429
SAMD9L
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.232; TCGA CESC -0.301; TCGA COAD -0.241; TCGA HNSC -0.245; TCGA KIRC -0.13; TCGA LUAD -0.215; TCGA LUSC -0.381; TCGA PAAD -0.126; TCGA UCEC -0.095
hsa-miR-429
MEX3B
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.081; TCGA COAD -0.387; TCGA ESCA -0.251; TCGA HNSC -0.163; TCGA KIRC -0.355; TCGA OV -0.146; TCGA PAAD -0.201; TCGA STAD -0.133; TCGA UCEC -0.187
hsa-miR-429
IKZF1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.331; TCGA BRCA -0.075; TCGA CESC -0.295; TCGA COAD -0.447; TCGA ESCA -0.148; TCGA HNSC -0.287; TCGA KIRC -0.468; TCGA KIRP -0.214; TCGA LUAD -0.219; TCGA LUSC -0.503; TCGA PAAD -0.582; TCGA UCEC -0.061
hsa-miR-429
GRIA3
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.389; TCGA BRCA -0.324; TCGA CESC -0.215; TCGA ESCA -0.199; TCGA HNSC -0.299; TCGA LIHC -0.13; TCGA LUSC -0.227; TCGA PRAD -0.119; TCGA STAD -0.234; TCGA UCEC -0.414
hsa-miR-429
GNB4
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.358; TCGA CESC -0.118; TCGA COAD -0.522; TCGA ESCA -0.401; TCGA HNSC -0.224; TCGA KIRC -0.219; TCGA KIRP -0.188; TCGA LUAD -0.24; TCGA LUSC -0.267; TCGA PAAD -0.365; TCGA PRAD -0.111; TCGA STAD -0.336; TCGA UCEC -0.136
hsa-miR-429
SGTB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.262; TCGA BRCA -0.124; TCGA CESC -0.166; TCGA COAD -0.195; TCGA ESCA -0.221; TCGA HNSC -0.199; TCGA KIRC -0.157; TCGA KIRP -0.277; TCGA LUAD -0.154; TCGA LUSC -0.209; TCGA PAAD -0.178; TCGA PRAD -0.06; TCGA STAD -0.196; TCGA UCEC -0.188
hsa-miR-429
PPP1R16B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.265; TCGA BRCA -0.375; TCGA CESC -0.234; TCGA COAD -0.459; TCGA ESCA -0.124; TCGA HNSC -0.284; TCGA LUAD -0.19; TCGA LUSC -0.551; TCGA PAAD -0.477; TCGA THCA -0.054; TCGA STAD -0.124; TCGA UCEC -0.261
hsa-miR-429
ENPP1
10 cancers: BLCA; BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.43; TCGA BRCA -0.069; TCGA HNSC -0.33; TCGA KIRP -0.319; TCGA LIHC -0.124; TCGA LUAD -0.136; TCGA LUSC -0.288; TCGA THCA -0.1; TCGA STAD -0.097; TCGA UCEC -0.287
hsa-miR-429
EPHA3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.263; TCGA BRCA -0.288; TCGA CESC -0.264; TCGA COAD -0.576; TCGA ESCA -0.309; TCGA HNSC -0.581; TCGA KIRC -0.454; TCGA LUAD -0.119; TCGA LUSC -0.453; TCGA PAAD -0.246; TCGA PRAD -0.139; TCGA STAD -0.387; TCGA UCEC -0.327
hsa-miR-429
FNDC1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.46; TCGA CESC -0.249; TCGA COAD -0.984; TCGA ESCA -0.417; TCGA HNSC -0.512; TCGA KIRC -0.304; TCGA KIRP -0.382; TCGA LUAD -0.142; TCGA LUSC -0.348; TCGA PAAD -0.418; TCGA PRAD -0.176; TCGA STAD -0.272
hsa-miR-429
PCDHB10
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; OV; STAD; UCEC
miRanda
TCGA BLCA -0.066; TCGA BRCA -0.073; TCGA CESC -0.168; TCGA COAD -0.167; TCGA ESCA -0.182; TCGA HNSC -0.157; TCGA KIRC -0.385; TCGA LUAD -0.123; TCGA OV -0.184; TCGA STAD -0.223; TCGA UCEC -0.124
hsa-miR-429
DACT3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.398; TCGA BRCA -0.152; TCGA CESC -0.373; TCGA COAD -0.783; TCGA ESCA -0.439; TCGA HNSC -0.282; TCGA LUAD -0.118; TCGA LUSC -0.344; TCGA OV -0.124; TCGA PAAD -0.316; TCGA PRAD -0.075; TCGA STAD -0.548; TCGA UCEC -0.542
hsa-miR-429
RORB
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.196; TCGA BRCA -0.343; TCGA CESC -0.343; TCGA ESCA -0.237; TCGA HNSC -0.177; TCGA LUSC -0.156; TCGA PAAD -0.366; TCGA STAD -0.354; TCGA UCEC -0.227
hsa-miR-429
SLC25A30
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.104; TCGA BRCA -0.119; TCGA COAD -0.109; TCGA ESCA -0.064; TCGA HNSC -0.155; TCGA KIRP -0.203; TCGA LIHC -0.089; TCGA LUAD -0.094; TCGA LUSC -0.172; TCGA PAAD -0.106; TCGA THCA -0.051; TCGA STAD -0.066; TCGA UCEC -0.09
hsa-miR-429
FADS1
11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD
miRanda
TCGA BLCA -0.089; TCGA COAD -0.355; TCGA ESCA -0.273; TCGA KIRC -0.17; TCGA KIRP -0.21; TCGA LIHC -0.112; TCGA LUAD -0.073; TCGA LUSC -0.115; TCGA OV -0.141; TCGA PAAD -0.123; TCGA STAD -0.137
hsa-miR-429
GJA1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.14; TCGA CESC -0.208; TCGA COAD -0.443; TCGA ESCA -0.442; TCGA HNSC -0.267; TCGA KIRC -0.386; TCGA LUAD -0.213; TCGA PAAD -0.245; TCGA PRAD -0.072; TCGA STAD -0.304; TCGA UCEC -0.106
hsa-miR-429
TNFSF12
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.204; TCGA BRCA -0.146; TCGA CESC -0.274; TCGA COAD -0.345; TCGA ESCA -0.255; TCGA HNSC -0.277; TCGA KIRC -0.08; TCGA LUAD -0.134; TCGA LUSC -0.457; TCGA PAAD -0.175; TCGA UCEC -0.17
hsa-miR-429
SFRP4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.662; TCGA BRCA -0.313; TCGA CESC -0.271; TCGA COAD -1.148; TCGA ESCA -0.523; TCGA HNSC -0.745; TCGA KIRC -0.263; TCGA KIRP -0.515; TCGA LUSC -0.462; TCGA PAAD -0.484; TCGA STAD -0.445; TCGA UCEC -0.405
hsa-miR-429
FAM129A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.424; TCGA BRCA -0.169; TCGA CESC -0.15; TCGA COAD -0.676; TCGA ESCA -0.367; TCGA HNSC -0.102; TCGA KIRC -0.247; TCGA PAAD -0.318; TCGA PRAD -0.138; TCGA THCA -0.101; TCGA STAD -0.518; TCGA UCEC -0.217
hsa-miR-429
ZFP36
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.139; TCGA BRCA -0.294; TCGA CESC -0.167; TCGA ESCA -0.171; TCGA HNSC -0.108; TCGA KIRC -0.133; TCGA LUAD -0.109; TCGA LUSC -0.26; TCGA STAD -0.159; TCGA UCEC -0.144
hsa-miR-429
FOXO1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.076; TCGA BRCA -0.363; TCGA CESC -0.163; TCGA COAD -0.187; TCGA ESCA -0.125; TCGA HNSC -0.223; TCGA LUAD -0.114; TCGA LUSC -0.147; TCGA PAAD -0.261; TCGA STAD -0.094; TCGA UCEC -0.166
hsa-miR-429
FER
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.185; TCGA BRCA -0.245; TCGA CESC -0.205; TCGA COAD -0.185; TCGA ESCA -0.172; TCGA HNSC -0.134; TCGA KIRP -0.106; TCGA LUAD -0.148; TCGA LUSC -0.195; TCGA PAAD -0.129; TCGA PRAD -0.066; TCGA STAD -0.183; TCGA UCEC -0.079
hsa-miR-429
CTSO
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.1; TCGA BRCA -0.158; TCGA CESC -0.118; TCGA COAD -0.224; TCGA ESCA -0.166; TCGA HNSC -0.291; TCGA KIRP -0.097; TCGA LIHC -0.071; TCGA LUAD -0.102; TCGA LUSC -0.321; TCGA PAAD -0.121; TCGA STAD -0.184; TCGA UCEC -0.163
hsa-miR-429
IFIT2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.257; TCGA CESC -0.247; TCGA COAD -0.3; TCGA ESCA -0.123; TCGA HNSC -0.27; TCGA KIRC -0.089; TCGA LUAD -0.213; TCGA LUSC -0.338; TCGA PAAD -0.18; TCGA STAD -0.108; TCGA UCEC -0.086
hsa-miR-429
CXCL10
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.378; TCGA CESC -0.384; TCGA COAD -0.469; TCGA HNSC -0.372; TCGA KIRC -0.532; TCGA KIRP -0.441; TCGA LUAD -0.307; TCGA LUSC -0.306; TCGA PAAD -0.436
hsa-miR-429
NAMPT
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA
miRanda
TCGA BLCA -0.15; TCGA BRCA -0.081; TCGA CESC -0.142; TCGA HNSC -0.087; TCGA KIRC -0.13; TCGA KIRP -0.148; TCGA LIHC -0.064; TCGA LUAD -0.206; TCGA PAAD -0.093; TCGA PRAD -0.093; TCGA THCA -0.05
hsa-miR-429
AP4E1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.07; TCGA BRCA -0.058; TCGA CESC -0.088; TCGA ESCA -0.058; TCGA HNSC -0.132; TCGA LUAD -0.076; TCGA PAAD -0.095; TCGA STAD -0.058; TCGA UCEC -0.059
hsa-miR-429
DNAJB4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.226; TCGA BRCA -0.246; TCGA CESC -0.183; TCGA COAD -0.259; TCGA ESCA -0.231; TCGA HNSC -0.202; TCGA KIRP -0.123; TCGA LUAD -0.272; TCGA LUSC -0.157; TCGA PAAD -0.235; TCGA PRAD -0.141; TCGA STAD -0.257; TCGA UCEC -0.274
hsa-miR-429
PLA2G7
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.203; TCGA CESC -0.221; TCGA COAD -0.401; TCGA HNSC -0.223; TCGA KIRC -0.804; TCGA KIRP -0.278; TCGA LUAD -0.127; TCGA LUSC -0.457; TCGA PAAD -0.391
hsa-miR-429
KCNA6
9 cancers: BLCA; BRCA; ESCA; HNSC; LUAD; LUSC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.338; TCGA BRCA -0.512; TCGA ESCA -0.487; TCGA HNSC -0.41; TCGA LUAD -0.186; TCGA LUSC -0.259; TCGA OV -0.356; TCGA STAD -0.418; TCGA UCEC -0.335
hsa-miR-429
IGSF1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.252; TCGA BRCA -0.304; TCGA CESC -0.27; TCGA COAD -0.633; TCGA ESCA -0.363; TCGA HNSC -0.242; TCGA PRAD -0.151; TCGA STAD -0.389; TCGA UCEC -0.272
hsa-miR-429
ALDH1L2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.488; TCGA BRCA -0.124; TCGA COAD -0.473; TCGA ESCA -0.259; TCGA HNSC -0.203; TCGA KIRC -0.351; TCGA KIRP -0.626; TCGA LUAD -0.193; TCGA LUSC -0.126; TCGA PAAD -0.292; TCGA PRAD -0.153; TCGA THCA -0.088; TCGA STAD -0.167
hsa-miR-429
ACO1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.117; TCGA BRCA -0.259; TCGA CESC -0.067; TCGA HNSC -0.082; TCGA KIRP -0.149; TCGA LIHC -0.084; TCGA LUAD -0.102; TCGA LUSC -0.155; TCGA PAAD -0.062; TCGA PRAD -0.051; TCGA UCEC -0.089
hsa-miR-429
CHURC1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.087; TCGA BRCA -0.101; TCGA CESC -0.069; TCGA COAD -0.064; TCGA ESCA -0.095; TCGA HNSC -0.093; TCGA LUAD -0.059; TCGA LUSC -0.151; TCGA PAAD -0.072; TCGA PRAD -0.068; TCGA UCEC -0.09
hsa-miR-429
LRRC8C
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.173; TCGA BRCA -0.217; TCGA CESC -0.21; TCGA COAD -0.334; TCGA ESCA -0.212; TCGA HNSC -0.231; TCGA KIRC -0.229; TCGA LUAD -0.203; TCGA LUSC -0.228; TCGA PAAD -0.27; TCGA PRAD -0.071; TCGA STAD -0.111; TCGA UCEC -0.263
hsa-miR-429
DCLK2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.113; TCGA BRCA -0.095; TCGA COAD -0.386; TCGA ESCA -0.331; TCGA HNSC -0.249; TCGA KIRP -0.14; TCGA LUAD -0.072; TCGA LUSC -0.33; TCGA PAAD -0.143; TCGA STAD -0.442; TCGA UCEC -0.243
hsa-miR-429
MATN3
10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.101; TCGA COAD -0.745; TCGA ESCA -0.135; TCGA HNSC -0.246; TCGA LUAD -0.167; TCGA LUSC -0.474; TCGA OV -0.194; TCGA PAAD -0.231; TCGA PRAD -0.071; TCGA STAD -0.129
hsa-miR-429
WDR7
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.066; TCGA BRCA -0.086; TCGA COAD -0.09; TCGA ESCA -0.084; TCGA HNSC -0.108; TCGA LIHC -0.067; TCGA LUAD -0.061; TCGA LUSC -0.108; TCGA PAAD -0.114; TCGA STAD -0.083; TCGA UCEC -0.054
hsa-miR-429
TRO
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.222; TCGA CESC -0.258; TCGA COAD -0.506; TCGA ESCA -0.309; TCGA HNSC -0.194; TCGA LIHC -0.163; TCGA OV -0.171; TCGA STAD -0.302; TCGA UCEC -0.32
hsa-miR-429
ADAMTS1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.238; TCGA BRCA -0.364; TCGA CESC -0.251; TCGA COAD -0.521; TCGA ESCA -0.375; TCGA HNSC -0.292; TCGA LUAD -0.254; TCGA LUSC -0.274; TCGA PAAD -0.356; TCGA PRAD -0.205; TCGA STAD -0.343; TCGA UCEC -0.234
hsa-miR-429
GPR84
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.268; TCGA CESC -0.189; TCGA COAD -0.387; TCGA ESCA -0.128; TCGA HNSC -0.233; TCGA KIRC -0.363; TCGA KIRP -0.242; TCGA LUAD -0.221; TCGA LUSC -0.225; TCGA PAAD -0.237
hsa-miR-429
GPR146
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.124; TCGA BRCA -0.38; TCGA COAD -0.284; TCGA ESCA -0.147; TCGA HNSC -0.098; TCGA KIRC -0.148; TCGA KIRP -0.131; TCGA LIHC -0.095; TCGA LUAD -0.105; TCGA LUSC -0.244; TCGA PAAD -0.121; TCGA STAD -0.174; TCGA UCEC -0.114
hsa-miR-429
ADCY9
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.242; TCGA CESC -0.141; TCGA COAD -0.093; TCGA ESCA -0.14; TCGA HNSC -0.172; TCGA KIRP -0.105; TCGA LUSC -0.166; TCGA PRAD -0.083; TCGA STAD -0.17; TCGA UCEC -0.24
hsa-miR-429
NAP1L3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.338; TCGA BRCA -0.248; TCGA CESC -0.317; TCGA COAD -0.785; TCGA ESCA -0.447; TCGA HNSC -0.483; TCGA KIRP -0.217; TCGA LUAD -0.212; TCGA LUSC -0.35; TCGA OV -0.205; TCGA PAAD -0.224; TCGA PRAD -0.13; TCGA STAD -0.467; TCGA UCEC -0.456
hsa-miR-429
FZD7
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.142; TCGA BRCA -0.118; TCGA COAD -0.265; TCGA ESCA -0.227; TCGA LUAD -0.099; TCGA PAAD -0.252; TCGA PRAD -0.081; TCGA STAD -0.272; TCGA UCEC -0.307
hsa-miR-429
CYP1B1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.391; TCGA BRCA -0.151; TCGA CESC -0.356; TCGA COAD -0.963; TCGA ESCA -0.628; TCGA HNSC -0.408; TCGA KIRP -0.205; TCGA LUAD -0.286; TCGA LUSC -0.475; TCGA PAAD -0.572; TCGA PRAD -0.19; TCGA STAD -0.533; TCGA UCEC -0.422
hsa-miR-429
DNAJB9
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.053; TCGA CESC -0.058; TCGA COAD -0.097; TCGA KIRC -0.08; TCGA KIRP -0.116; TCGA LIHC -0.071; TCGA LUAD -0.064; TCGA LUSC -0.175; TCGA PRAD -0.066; TCGA UCEC -0.083
hsa-miR-429
ADAM12
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD
miRanda; miRNATAP
TCGA BLCA -0.295; TCGA CESC -0.197; TCGA COAD -0.842; TCGA ESCA -0.184; TCGA HNSC -0.409; TCGA KIRC -0.583; TCGA LUAD -0.268; TCGA PAAD -0.541; TCGA PRAD -0.104
hsa-miR-429
TDRD10
9 cancers: BLCA; BRCA; ESCA; KIRC; LIHC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.268; TCGA BRCA -0.373; TCGA ESCA -0.255; TCGA KIRC -0.134; TCGA LIHC -0.096; TCGA LUSC -0.416; TCGA PAAD -0.325; TCGA STAD -0.293; TCGA UCEC -0.372
hsa-miR-429
ZNF831
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.342; TCGA BRCA -0.189; TCGA CESC -0.328; TCGA COAD -0.484; TCGA ESCA -0.161; TCGA HNSC -0.329; TCGA KIRC -0.461; TCGA LUAD -0.154; TCGA LUSC -0.615; TCGA PAAD -0.59; TCGA STAD -0.123; TCGA UCEC -0.107
hsa-miR-429
KCNA3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.294; TCGA BRCA -0.203; TCGA CESC -0.386; TCGA COAD -0.469; TCGA HNSC -0.337; TCGA KIRC -0.314; TCGA LUAD -0.157; TCGA LUSC -0.664; TCGA PAAD -0.52; TCGA PRAD -0.092; TCGA UCEC -0.152
hsa-miR-429
CR1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.493; TCGA BRCA -0.347; TCGA CESC -0.248; TCGA COAD -0.775; TCGA ESCA -0.39; TCGA HNSC -0.416; TCGA LUAD -0.303; TCGA LUSC -0.667; TCGA PAAD -0.809; TCGA PRAD -0.094; TCGA STAD -0.164
hsa-miR-429
NAALAD2
10 cancers: BLCA; BRCA; CESC; ESCA; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.462; TCGA CESC -0.183; TCGA ESCA -0.114; TCGA LUSC -0.149; TCGA OV -0.235; TCGA PAAD -0.258; TCGA PRAD -0.113; TCGA STAD -0.221; TCGA UCEC -0.454
hsa-miR-429
CLEC2B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.304; TCGA BRCA -0.193; TCGA CESC -0.531; TCGA COAD -0.442; TCGA ESCA -0.272; TCGA HNSC -0.135; TCGA KIRC -0.451; TCGA LUAD -0.214; TCGA PAAD -0.26; TCGA STAD -0.18; TCGA UCEC -0.251
hsa-miR-429
CCDC3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.172; TCGA BRCA -0.413; TCGA CESC -0.126; TCGA COAD -0.316; TCGA ESCA -0.191; TCGA HNSC -0.148; TCGA LUAD -0.08; TCGA LUSC -0.124; TCGA PAAD -0.236; TCGA PRAD -0.131; TCGA STAD -0.184; TCGA UCEC -0.238
hsa-miR-429
PABPC4L
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.262; TCGA BRCA -0.184; TCGA CESC -0.256; TCGA COAD -0.523; TCGA ESCA -0.27; TCGA HNSC -0.248; TCGA KIRC -0.223; TCGA LIHC -0.066; TCGA LUAD -0.196; TCGA PAAD -0.251; TCGA STAD -0.387; TCGA UCEC -0.226
hsa-miR-429
SVEP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.305; TCGA BRCA -0.611; TCGA CESC -0.329; TCGA COAD -0.502; TCGA ESCA -0.423; TCGA HNSC -0.3; TCGA LUAD -0.337; TCGA LUSC -0.381; TCGA PAAD -0.535; TCGA STAD -0.386; TCGA UCEC -0.268
hsa-miR-429
CPPED1
10 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.186; TCGA BRCA -0.071; TCGA ESCA -0.093; TCGA KIRP -0.256; TCGA LIHC -0.134; TCGA LUAD -0.115; TCGA LUSC -0.073; TCGA PAAD -0.134; TCGA PRAD -0.056; TCGA STAD -0.079
hsa-miR-429
CCL8
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.477; TCGA BRCA -0.163; TCGA CESC -0.304; TCGA COAD -0.671; TCGA ESCA -0.344; TCGA HNSC -0.396; TCGA LIHC -0.122; TCGA LUAD -0.345; TCGA LUSC -0.485; TCGA PAAD -0.344; TCGA PRAD -0.117
hsa-miR-429
TMEM119
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.227; TCGA BRCA -0.145; TCGA CESC -0.242; TCGA COAD -0.475; TCGA ESCA -0.179; TCGA HNSC -0.443; TCGA KIRC -0.139; TCGA KIRP -0.207; TCGA LUAD -0.14; TCGA LUSC -0.509; TCGA OV -0.207; TCGA PAAD -0.384; TCGA PRAD -0.083; TCGA STAD -0.119; TCGA UCEC -0.293
hsa-miR-429
CFH
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.208; TCGA BRCA -0.34; TCGA CESC -0.262; TCGA COAD -0.658; TCGA ESCA -0.333; TCGA HNSC -0.34; TCGA KIRC -0.156; TCGA LIHC -0.105; TCGA LUAD -0.154; TCGA LUSC -0.224; TCGA PAAD -0.326; TCGA PRAD -0.11; TCGA STAD -0.22
hsa-miR-429
PARVA
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.21; TCGA BRCA -0.175; TCGA COAD -0.136; TCGA ESCA -0.151; TCGA HNSC -0.182; TCGA KIRP -0.079; TCGA LUAD -0.056; TCGA LUSC -0.165; TCGA PAAD -0.117; TCGA PRAD -0.093; TCGA STAD -0.281; TCGA UCEC -0.115
hsa-miR-429
PCDHB15
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.249; TCGA CESC -0.235; TCGA COAD -0.275; TCGA ESCA -0.111; TCGA HNSC -0.233; TCGA KIRC -0.175; TCGA LUAD -0.158; TCGA LUSC -0.172; TCGA OV -0.19; TCGA STAD -0.223; TCGA UCEC -0.209
hsa-miR-429
CD40LG
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BLCA -0.286; TCGA BRCA -0.166; TCGA CESC -0.261; TCGA COAD -0.225; TCGA HNSC -0.275; TCGA KIRC -0.392; TCGA LUAD -0.139; TCGA LUSC -0.583; TCGA PAAD -0.476; TCGA UCEC -0.104
hsa-miR-429
SNX2
9 cancers: BLCA; BRCA; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.09; TCGA ESCA -0.06; TCGA KIRP -0.124; TCGA LIHC -0.067; TCGA LUAD -0.126; TCGA LUSC -0.141; TCGA PAAD -0.123; TCGA UCEC -0.057
hsa-miR-429
ARHGAP29
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.151; TCGA BRCA -0.134; TCGA COAD -0.283; TCGA HNSC -0.337; TCGA LUAD -0.146; TCGA LUSC -0.359; TCGA PAAD -0.181; TCGA STAD -0.17; TCGA UCEC -0.18
hsa-miR-429
ACAT1
9 cancers: BLCA; BRCA; HNSC; LIHC; LUSC; PAAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.194; TCGA BRCA -0.13; TCGA HNSC -0.068; TCGA LIHC -0.081; TCGA LUSC -0.12; TCGA PAAD -0.087; TCGA THCA -0.068; TCGA STAD -0.06; TCGA UCEC -0.103
hsa-miR-429
LRP12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.115; TCGA BRCA -0.113; TCGA CESC -0.187; TCGA COAD -0.182; TCGA ESCA -0.351; TCGA HNSC -0.118; TCGA KIRP -0.134; TCGA LUAD -0.167; TCGA OV -0.126; TCGA PAAD -0.192; TCGA STAD -0.175; TCGA UCEC -0.172
hsa-miR-429
TLN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.231; TCGA BRCA -0.144; TCGA CESC -0.191; TCGA COAD -0.186; TCGA ESCA -0.198; TCGA HNSC -0.276; TCGA KIRC -0.076; TCGA KIRP -0.088; TCGA LUAD -0.137; TCGA LUSC -0.307; TCGA PAAD -0.173; TCGA PRAD -0.081; TCGA STAD -0.267; TCGA UCEC -0.161
hsa-miR-429
PELO
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; STAD; UCEC
miRanda
TCGA BLCA -0.104; TCGA CESC -0.119; TCGA COAD -0.066; TCGA ESCA -0.062; TCGA HNSC -0.067; TCGA KIRC -0.098; TCGA KIRP -0.204; TCGA LUAD -0.061; TCGA LUSC -0.075; TCGA OV -0.063; TCGA STAD -0.105; TCGA UCEC -0.061
hsa-miR-429
HAS2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.324; TCGA BRCA -0.288; TCGA CESC -0.397; TCGA COAD -0.281; TCGA ESCA -0.337; TCGA HNSC -0.436; TCGA LUAD -0.288; TCGA LUSC -0.392; TCGA OV -0.236; TCGA PAAD -0.321; TCGA PRAD -0.096; TCGA STAD -0.083; TCGA UCEC -0.165
hsa-miR-429
AKAP5
9 cancers: BLCA; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.133; TCGA ESCA -0.111; TCGA HNSC -0.152; TCGA LIHC -0.062; TCGA LUAD -0.167; TCGA LUSC -0.321; TCGA PAAD -0.105; TCGA STAD -0.076; TCGA UCEC -0.144
hsa-miR-429
RNF180
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.291; TCGA CESC -0.243; TCGA COAD -0.626; TCGA ESCA -0.309; TCGA HNSC -0.234; TCGA KIRP -0.158; TCGA LUSC -0.374; TCGA PAAD -0.154; TCGA PRAD -0.054; TCGA STAD -0.413
hsa-miR-429
RHOH
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD
miRanda
TCGA BLCA -0.412; TCGA CESC -0.258; TCGA COAD -0.364; TCGA ESCA -0.14; TCGA HNSC -0.21; TCGA KIRC -0.501; TCGA LUAD -0.09; TCGA LUSC -0.411; TCGA PAAD -0.463
hsa-miR-429
ACOX2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.466; TCGA BRCA -0.211; TCGA CESC -0.224; TCGA ESCA -0.208; TCGA HNSC -0.221; TCGA KIRP -0.237; TCGA LIHC -0.228; TCGA LUSC -0.454; TCGA PAAD -0.166; TCGA STAD -0.261; TCGA UCEC -0.283
hsa-miR-429
UGCG
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.13; TCGA COAD -0.185; TCGA ESCA -0.107; TCGA HNSC -0.204; TCGA KIRC -0.084; TCGA KIRP -0.265; TCGA LUAD -0.083; TCGA LUSC -0.212; TCGA PRAD -0.099; TCGA STAD -0.05
hsa-miR-429
CCR2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.347; TCGA BRCA -0.118; TCGA CESC -0.44; TCGA COAD -0.632; TCGA ESCA -0.19; TCGA HNSC -0.404; TCGA KIRC -0.284; TCGA LUAD -0.275; TCGA LUSC -0.575; TCGA PAAD -0.495; TCGA STAD -0.11; TCGA UCEC -0.153
hsa-miR-429
SELE
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.182; TCGA BRCA -0.242; TCGA CESC -0.312; TCGA COAD -0.749; TCGA ESCA -0.201; TCGA HNSC -0.31; TCGA LUAD -0.268; TCGA LUSC -0.627; TCGA PAAD -0.362; TCGA PRAD -0.236; TCGA STAD -0.175; TCGA UCEC -0.275
hsa-miR-429
CHSY3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.293; TCGA BRCA -0.138; TCGA CESC -0.254; TCGA COAD -0.51; TCGA ESCA -0.166; TCGA HNSC -0.302; TCGA KIRC -0.598; TCGA KIRP -0.276; TCGA LIHC -0.063; TCGA LUAD -0.185; TCGA LUSC -0.259; TCGA PAAD -0.312; TCGA STAD -0.075; TCGA UCEC -0.237
hsa-miR-429
ST8SIA4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.205; TCGA BRCA -0.095; TCGA CESC -0.271; TCGA COAD -0.348; TCGA ESCA -0.141; TCGA HNSC -0.186; TCGA KIRC -0.687; TCGA KIRP -0.301; TCGA LUAD -0.13; TCGA LUSC -0.336; TCGA PAAD -0.413; TCGA PRAD -0.079; TCGA UCEC -0.093
hsa-miR-429
EID1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; OV; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.088; TCGA CESC -0.073; TCGA COAD -0.165; TCGA ESCA -0.101; TCGA HNSC -0.116; TCGA KIRP -0.073; TCGA LIHC -0.071; TCGA LUAD -0.069; TCGA OV -0.051; TCGA PAAD -0.083; TCGA STAD -0.223; TCGA UCEC -0.155
hsa-miR-429
BCHE
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.516; TCGA BRCA -0.456; TCGA CESC -0.332; TCGA COAD -1.041; TCGA ESCA -0.719; TCGA KIRP -0.441; TCGA LUAD -0.298; TCGA OV -0.496; TCGA PAAD -0.453; TCGA PRAD -0.208; TCGA STAD -0.706; TCGA UCEC -0.777
hsa-miR-429
CELF2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.42; TCGA BRCA -0.348; TCGA CESC -0.294; TCGA ESCA -0.417; TCGA HNSC -0.35; TCGA KIRC -0.166; TCGA LUAD -0.086; TCGA LUSC -0.498; TCGA PAAD -0.515; TCGA PRAD -0.117; TCGA STAD -0.37; TCGA UCEC -0.258
hsa-miR-429
ERC1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.181; TCGA BRCA -0.083; TCGA CESC -0.094; TCGA COAD -0.1; TCGA ESCA -0.138; TCGA HNSC -0.118; TCGA LUAD -0.097; TCGA PRAD -0.058; TCGA STAD -0.168
hsa-miR-429
SLC30A4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.309; TCGA BRCA -0.202; TCGA CESC -0.153; TCGA COAD -0.199; TCGA ESCA -0.114; TCGA HNSC -0.305; TCGA KIRP -0.212; TCGA LIHC -0.089; TCGA LUAD -0.235; TCGA LUSC -0.14; TCGA PAAD -0.165; TCGA PRAD -0.077; TCGA STAD -0.113; TCGA UCEC -0.149
hsa-miR-429
FKBP14
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.089; TCGA BRCA -0.108; TCGA CESC -0.12; TCGA COAD -0.198; TCGA ESCA -0.1; TCGA HNSC -0.181; TCGA KIRC -0.102; TCGA KIRP -0.082; TCGA LUAD -0.108; TCGA PAAD -0.195; TCGA PRAD -0.07; TCGA STAD -0.109; TCGA UCEC -0.061
hsa-miR-429
LNPEP
10 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.11; TCGA BRCA -0.207; TCGA ESCA -0.094; TCGA HNSC -0.199; TCGA LIHC -0.052; TCGA LUAD -0.176; TCGA LUSC -0.145; TCGA PAAD -0.132; TCGA PRAD -0.06; TCGA STAD -0.155
hsa-miR-429
PDE4D
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.167; TCGA BRCA -0.142; TCGA CESC -0.141; TCGA COAD -0.162; TCGA ESCA -0.148; TCGA HNSC -0.162; TCGA LUSC -0.227; TCGA OV -0.21; TCGA PRAD -0.05; TCGA STAD -0.208; TCGA UCEC -0.226
hsa-miR-429
SYT11
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.349; TCGA BRCA -0.178; TCGA CESC -0.211; TCGA COAD -0.561; TCGA ESCA -0.253; TCGA HNSC -0.329; TCGA KIRC -0.063; TCGA LUAD -0.142; TCGA LUSC -0.346; TCGA OV -0.141; TCGA PAAD -0.217; TCGA PRAD -0.114; TCGA STAD -0.332; TCGA UCEC -0.215
hsa-miR-429
RAB30
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.186; TCGA BRCA -0.083; TCGA CESC -0.134; TCGA COAD -0.176; TCGA ESCA -0.111; TCGA HNSC -0.188; TCGA KIRP -0.226; TCGA PAAD -0.198; TCGA STAD -0.111; TCGA UCEC -0.152
hsa-miR-429
FGF2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.41; TCGA BRCA -0.507; TCGA CESC -0.437; TCGA COAD -0.659; TCGA ESCA -0.39; TCGA HNSC -0.18; TCGA LIHC -0.192; TCGA LUAD -0.275; TCGA LUSC -0.244; TCGA OV -0.186; TCGA PAAD -0.322; TCGA PRAD -0.126; TCGA STAD -0.404; TCGA UCEC -0.52
hsa-miR-429
PIK3R1
9 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; STAD
mirMAP; miRNATAP
TCGA BLCA -0.055; TCGA BRCA -0.225; TCGA ESCA -0.127; TCGA HNSC -0.216; TCGA LIHC -0.082; TCGA LUAD -0.095; TCGA PAAD -0.217; TCGA PRAD -0.051; TCGA STAD -0.193
hsa-miR-429
GFRA1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.253; TCGA BRCA -0.15; TCGA CESC -0.56; TCGA COAD -0.737; TCGA ESCA -0.385; TCGA HNSC -0.378; TCGA LIHC -0.241; TCGA LUSC -0.424; TCGA OV -0.34; TCGA PAAD -0.38; TCGA PRAD -0.132; TCGA STAD -0.545; TCGA UCEC -0.456
hsa-miR-429
MARVELD1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.276; TCGA BRCA -0.09; TCGA CESC -0.208; TCGA COAD -0.229; TCGA ESCA -0.306; TCGA HNSC -0.193; TCGA KIRC -0.266; TCGA KIRP -0.147; TCGA LUAD -0.227; TCGA LUSC -0.115; TCGA PAAD -0.104; TCGA STAD -0.259; TCGA UCEC -0.274
hsa-miR-429
SLFN5
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD
mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.236; TCGA COAD -0.376; TCGA ESCA -0.09; TCGA HNSC -0.161; TCGA KIRC -0.173; TCGA LUAD -0.086; TCGA LUSC -0.148; TCGA PAAD -0.213; TCGA THCA -0.058; TCGA STAD -0.098
hsa-miR-429
SGCD
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.493; TCGA BRCA -0.318; TCGA COAD -0.751; TCGA ESCA -0.352; TCGA HNSC -0.74; TCGA LUAD -0.204; TCGA LUSC -0.478; TCGA PAAD -0.372; TCGA PRAD -0.258; TCGA THCA -0.133; TCGA STAD -0.439; TCGA UCEC -0.107
hsa-miR-429
PYGO1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.294; TCGA BRCA -0.357; TCGA CESC -0.242; TCGA ESCA -0.314; TCGA HNSC -0.329; TCGA KIRP -0.413; TCGA LUAD -0.143; TCGA LUSC -0.223; TCGA OV -0.156; TCGA PAAD -0.372; TCGA STAD -0.451; TCGA UCEC -0.31
hsa-miR-429
CHST11
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.365; TCGA CESC -0.401; TCGA COAD -0.469; TCGA ESCA -0.232; TCGA HNSC -0.242; TCGA KIRC -0.418; TCGA KIRP -0.402; TCGA LUAD -0.264; TCGA LUSC -0.346; TCGA PAAD -0.258; TCGA STAD -0.115; TCGA UCEC -0.104
hsa-miR-429
THEMIS
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
mirMAP
TCGA BLCA -0.331; TCGA BRCA -0.172; TCGA CESC -0.226; TCGA COAD -0.316; TCGA HNSC -0.289; TCGA KIRC -0.521; TCGA LUAD -0.281; TCGA LUSC -0.364; TCGA PAAD -0.624; TCGA UCEC -0.099
hsa-miR-429
MSRB3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.482; TCGA BRCA -0.388; TCGA CESC -0.441; TCGA COAD -0.805; TCGA ESCA -0.483; TCGA HNSC -0.476; TCGA KIRC -0.147; TCGA KIRP -0.162; TCGA LUAD -0.28; TCGA LUSC -0.582; TCGA OV -0.197; TCGA PAAD -0.336; TCGA PRAD -0.124; TCGA THCA -0.057; TCGA STAD -0.551; TCGA UCEC -0.527
hsa-miR-429
FZD4
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.077; TCGA BRCA -0.42; TCGA CESC -0.223; TCGA COAD -0.302; TCGA HNSC -0.312; TCGA KIRC -0.075; TCGA LIHC -0.088; TCGA LUAD -0.14; TCGA LUSC -0.347; TCGA PAAD -0.28; TCGA STAD -0.188; TCGA UCEC -0.241
hsa-miR-429
ARL10
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.184; TCGA BRCA -0.223; TCGA CESC -0.257; TCGA COAD -0.449; TCGA ESCA -0.328; TCGA HNSC -0.142; TCGA KIRC -0.142; TCGA LUAD -0.161; TCGA LUSC -0.111; TCGA PAAD -0.213; TCGA STAD -0.288; TCGA UCEC -0.227
hsa-miR-429
FAM26E
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.367; TCGA BRCA -0.276; TCGA CESC -0.332; TCGA COAD -0.619; TCGA ESCA -0.283; TCGA HNSC -0.474; TCGA LUAD -0.284; TCGA LUSC -0.392; TCGA PAAD -0.341; TCGA PRAD -0.102; TCGA STAD -0.191; TCGA UCEC -0.284
hsa-miR-429
CIITA
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD
mirMAP
TCGA BLCA -0.255; TCGA BRCA -0.057; TCGA CESC -0.182; TCGA COAD -0.331; TCGA HNSC -0.21; TCGA KIRC -0.163; TCGA LUAD -0.129; TCGA LUSC -0.499; TCGA PAAD -0.419
hsa-miR-429
BEND4
9 cancers: BLCA; COAD; ESCA; LUAD; LUSC; OV; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.237; TCGA COAD -0.423; TCGA ESCA -0.276; TCGA LUAD -0.221; TCGA LUSC -0.355; TCGA OV -0.203; TCGA PAAD -0.504; TCGA STAD -0.148; TCGA UCEC -0.298
hsa-miR-429
SLC6A17
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.287; TCGA CESC -0.38; TCGA COAD -0.586; TCGA ESCA -0.314; TCGA HNSC -0.405; TCGA LUAD -0.264; TCGA LUSC -0.292; TCGA THCA -0.167; TCGA STAD -0.302
hsa-miR-429
MYO5A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.206; TCGA BRCA -0.093; TCGA CESC -0.255; TCGA COAD -0.531; TCGA ESCA -0.324; TCGA HNSC -0.164; TCGA KIRP -0.153; TCGA LIHC -0.071; TCGA LUAD -0.161; TCGA LUSC -0.117; TCGA PAAD -0.281; TCGA STAD -0.202; TCGA UCEC -0.143
hsa-miR-429
SFMBT2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.297; TCGA BRCA -0.161; TCGA CESC -0.423; TCGA COAD -0.543; TCGA ESCA -0.288; TCGA HNSC -0.273; TCGA KIRC -0.105; TCGA LUAD -0.209; TCGA LUSC -0.386; TCGA PAAD -0.401; TCGA PRAD -0.067; TCGA THCA -0.093; TCGA STAD -0.178; TCGA UCEC -0.315
hsa-miR-429
C17orf51
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.192; TCGA BRCA -0.24; TCGA CESC -0.186; TCGA COAD -0.114; TCGA ESCA -0.112; TCGA HNSC -0.087; TCGA KIRP -0.176; TCGA LUAD -0.096; TCGA PAAD -0.179; TCGA PRAD -0.057; TCGA STAD -0.169; TCGA UCEC -0.249
hsa-miR-429
PRX
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.138; TCGA BRCA -0.14; TCGA CESC -0.196; TCGA COAD -0.205; TCGA ESCA -0.173; TCGA HNSC -0.082; TCGA LUAD -0.13; TCGA LUSC -0.324; TCGA STAD -0.202; TCGA UCEC -0.321
hsa-miR-429
CLIP3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.338; TCGA BRCA -0.18; TCGA CESC -0.232; TCGA COAD -0.605; TCGA ESCA -0.451; TCGA HNSC -0.193; TCGA KIRP -0.357; TCGA LUSC -0.175; TCGA OV -0.23; TCGA PAAD -0.176; TCGA PRAD -0.101; TCGA STAD -0.489; TCGA UCEC -0.399
hsa-miR-429
CPEB4
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.107; TCGA CESC -0.081; TCGA COAD -0.093; TCGA HNSC -0.244; TCGA KIRP -0.112; TCGA LIHC -0.05; TCGA LUSC -0.222; TCGA STAD -0.073; TCGA UCEC -0.063
hsa-miR-429
SOX5
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.209; TCGA BRCA -0.401; TCGA COAD -0.563; TCGA HNSC -0.146; TCGA LIHC -0.076; TCGA LUAD -0.194; TCGA LUSC -0.25; TCGA PAAD -0.164; TCGA PRAD -0.117; TCGA STAD -0.318
hsa-miR-429
FNDC5
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.073; TCGA BRCA -0.219; TCGA CESC -0.132; TCGA COAD -0.245; TCGA ESCA -0.343; TCGA HNSC -0.303; TCGA LIHC -0.256; TCGA PAAD -0.23; TCGA PRAD -0.129; TCGA STAD -0.485; TCGA UCEC -0.358
hsa-miR-429
ADORA3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.305; TCGA CESC -0.256; TCGA COAD -0.437; TCGA ESCA -0.229; TCGA HNSC -0.202; TCGA KIRC -0.589; TCGA KIRP -0.37; TCGA LUAD -0.174; TCGA LUSC -0.414; TCGA PAAD -0.336; TCGA PRAD -0.078; TCGA STAD -0.157
hsa-miR-429
TMEM169
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.178; TCGA BRCA -0.136; TCGA COAD -0.409; TCGA ESCA -0.209; TCGA HNSC -0.143; TCGA LIHC -0.064; TCGA LUAD -0.096; TCGA LUSC -0.25; TCGA PAAD -0.175; TCGA STAD -0.103; TCGA UCEC -0.08
hsa-miR-429
DSEL
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.193; TCGA BRCA -0.343; TCGA COAD -0.58; TCGA ESCA -0.352; TCGA HNSC -0.299; TCGA KIRC -0.095; TCGA LUAD -0.192; TCGA LUSC -0.32; TCGA OV -0.15; TCGA PAAD -0.256; TCGA PRAD -0.071; TCGA STAD -0.325; TCGA UCEC -0.325
hsa-miR-429
ENAH
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; STAD
miRNATAP
TCGA BLCA -0.133; TCGA CESC -0.079; TCGA COAD -0.108; TCGA ESCA -0.127; TCGA HNSC -0.186; TCGA KIRC -0.091; TCGA KIRP -0.133; TCGA PAAD -0.1; TCGA STAD -0.198
hsa-miR-429
PAPPA
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.323; TCGA BRCA -0.223; TCGA CESC -0.497; TCGA COAD -0.521; TCGA ESCA -0.237; TCGA HNSC -0.416; TCGA LUSC -0.294; TCGA OV -0.218; TCGA PAAD -0.275; TCGA PRAD -0.085; TCGA STAD -0.135; TCGA UCEC -0.459
hsa-miR-429
SH3D19
9 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.088; TCGA BRCA -0.339; TCGA HNSC -0.126; TCGA LIHC -0.07; TCGA LUAD -0.103; TCGA LUSC -0.195; TCGA PRAD -0.071; TCGA STAD -0.121; TCGA UCEC -0.154
hsa-miR-429
ACVR1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; STAD; UCEC
miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.12; TCGA CESC -0.071; TCGA COAD -0.125; TCGA ESCA -0.067; TCGA HNSC -0.122; TCGA KIRC -0.071; TCGA KIRP -0.221; TCGA STAD -0.067; TCGA UCEC -0.053
hsa-miR-429
SORCS1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.34; TCGA BRCA -0.266; TCGA CESC -0.261; TCGA COAD -1.156; TCGA ESCA -0.83; TCGA HNSC -0.409; TCGA LUSC -0.281; TCGA OV -0.397; TCGA PAAD -0.404; TCGA PRAD -0.131; TCGA THCA -0.242; TCGA STAD -0.698; TCGA UCEC -0.292
hsa-miR-429
MAF
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.323; TCGA BRCA -0.239; TCGA CESC -0.39; TCGA COAD -0.447; TCGA ESCA -0.331; TCGA HNSC -0.267; TCGA KIRC -0.242; TCGA KIRP -0.263; TCGA LIHC -0.064; TCGA LUAD -0.151; TCGA PAAD -0.216; TCGA PRAD -0.102; TCGA STAD -0.194; TCGA UCEC -0.369
hsa-miR-429
BBX
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.087; TCGA CESC -0.061; TCGA COAD -0.119; TCGA ESCA -0.086; TCGA HNSC -0.082; TCGA LUAD -0.098; TCGA PRAD -0.053; TCGA STAD -0.131; TCGA UCEC -0.069
hsa-miR-429
PRPH2
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.228; TCGA BRCA -0.245; TCGA COAD -0.523; TCGA ESCA -0.18; TCGA HNSC -0.175; TCGA LUSC -0.337; TCGA PAAD -0.26; TCGA STAD -0.254; TCGA UCEC -0.267
hsa-miR-429
CPEB1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.538; TCGA BRCA -0.424; TCGA CESC -0.449; TCGA COAD -1.006; TCGA ESCA -0.703; TCGA HNSC -0.25; TCGA KIRP -0.787; TCGA LUAD -0.287; TCGA LUSC -0.335; TCGA OV -0.26; TCGA PAAD -0.365; TCGA STAD -0.599; TCGA UCEC -0.553
hsa-miR-429
PCDH17
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.09; TCGA CESC -0.153; TCGA COAD -0.348; TCGA HNSC -0.291; TCGA KIRC -0.413; TCGA LUAD -0.21; TCGA LUSC -0.3; TCGA PAAD -0.253; TCGA STAD -0.108; TCGA UCEC -0.146
hsa-miR-429
PITPNM2
10 cancers: BLCA; BRCA; CESC; ESCA; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.068; TCGA CESC -0.174; TCGA ESCA -0.197; TCGA LIHC -0.11; TCGA LUAD -0.061; TCGA LUSC -0.063; TCGA PRAD -0.099; TCGA STAD -0.202; TCGA UCEC -0.111
hsa-miR-429
NOVA2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.057; TCGA BRCA -0.176; TCGA CESC -0.265; TCGA COAD -0.316; TCGA HNSC -0.213; TCGA KIRC -0.338; TCGA LUAD -0.211; TCGA LUSC -0.389; TCGA OV -0.182; TCGA PRAD -0.078; TCGA STAD -0.106; TCGA UCEC -0.172
hsa-miR-429
PGF
9 cancers: BLCA; CESC; COAD; ESCA; KIRC; OV; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.085; TCGA CESC -0.261; TCGA COAD -0.158; TCGA ESCA -0.172; TCGA KIRC -0.773; TCGA OV -0.162; TCGA PAAD -0.104; TCGA PRAD -0.1; TCGA UCEC -0.155
hsa-miR-429
TSPAN18
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.309; TCGA BRCA -0.214; TCGA CESC -0.369; TCGA COAD -0.416; TCGA ESCA -0.185; TCGA KIRC -0.276; TCGA LUAD -0.251; TCGA LUSC -0.326; TCGA PAAD -0.31; TCGA PRAD -0.131; TCGA STAD -0.344; TCGA UCEC -0.426
hsa-miR-429
KLF7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.166; TCGA BRCA -0.205; TCGA CESC -0.172; TCGA COAD -0.273; TCGA ESCA -0.332; TCGA HNSC -0.211; TCGA KIRC -0.153; TCGA LUSC -0.207; TCGA PAAD -0.107; TCGA PRAD -0.082; TCGA STAD -0.193; TCGA UCEC -0.166
hsa-miR-429
VWF
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.369; TCGA CESC -0.238; TCGA COAD -0.41; TCGA ESCA -0.111; TCGA HNSC -0.245; TCGA KIRC -0.658; TCGA KIRP -0.224; TCGA LIHC -0.213; TCGA LUAD -0.212; TCGA LUSC -0.469; TCGA PAAD -0.234; TCGA PRAD -0.062; TCGA THCA -0.072; TCGA STAD -0.137; TCGA UCEC -0.134
hsa-miR-429
RAI2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.203; TCGA BRCA -0.287; TCGA CESC -0.183; TCGA COAD -0.453; TCGA ESCA -0.141; TCGA HNSC -0.279; TCGA LUAD -0.09; TCGA LUSC -0.428; TCGA STAD -0.345; TCGA UCEC -0.106
hsa-miR-429
TGFBR2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.182; TCGA BRCA -0.405; TCGA CESC -0.155; TCGA COAD -0.17; TCGA HNSC -0.415; TCGA LUAD -0.182; TCGA LUSC -0.464; TCGA PAAD -0.159; TCGA PRAD -0.103; TCGA STAD -0.157; TCGA UCEC -0.189
hsa-miR-429
ESR1
10 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.206; TCGA COAD -0.64; TCGA ESCA -0.407; TCGA HNSC -0.244; TCGA KIRP -0.231; TCGA LIHC -0.114; TCGA LUAD -0.178; TCGA LUSC -0.29; TCGA PAAD -0.392; TCGA STAD -0.317
hsa-miR-429
RUNX1T1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.372; TCGA BRCA -0.509; TCGA CESC -0.326; TCGA COAD -0.746; TCGA ESCA -0.36; TCGA HNSC -0.512; TCGA LUAD -0.184; TCGA LUSC -0.632; TCGA PAAD -0.239; TCGA PRAD -0.195; TCGA STAD -0.437; TCGA UCEC -0.437
hsa-miR-429
SETD7
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.187; TCGA CESC -0.115; TCGA COAD -0.068; TCGA HNSC -0.182; TCGA KIRC -0.158; TCGA KIRP -0.164; TCGA LIHC -0.1; TCGA LUAD -0.083; TCGA LUSC -0.136; TCGA PAAD -0.112; TCGA STAD -0.17; TCGA UCEC -0.262
hsa-miR-429
SPRED1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; OV; PRAD; UCEC
miRNATAP
TCGA BLCA -0.187; TCGA BRCA -0.135; TCGA CESC -0.088; TCGA HNSC -0.162; TCGA KIRC -0.17; TCGA LUAD -0.145; TCGA LUSC -0.184; TCGA OV -0.064; TCGA PRAD -0.063; TCGA UCEC -0.14
hsa-miR-429
ABCA1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.108; TCGA BRCA -0.258; TCGA CESC -0.236; TCGA COAD -0.301; TCGA ESCA -0.266; TCGA HNSC -0.249; TCGA KIRC -0.345; TCGA KIRP -0.191; TCGA LUAD -0.198; TCGA LUSC -0.136; TCGA PAAD -0.228; TCGA STAD -0.163
hsa-miR-429
TGFB2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.354; TCGA BRCA -0.114; TCGA CESC -0.318; TCGA COAD -0.403; TCGA ESCA -0.283; TCGA HNSC -0.213; TCGA LUSC -0.251; TCGA OV -0.188; TCGA PRAD -0.105; TCGA STAD -0.183; TCGA UCEC -0.198
hsa-miR-429
PCDHGC3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; UCEC
miRNATAP
TCGA BLCA -0.192; TCGA BRCA -0.145; TCGA CESC -0.306; TCGA COAD -0.275; TCGA ESCA -0.258; TCGA HNSC -0.203; TCGA KIRC -0.272; TCGA LUAD -0.147; TCGA LUSC -0.162; TCGA UCEC -0.179
hsa-miR-429
PCDHGB4
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; UCEC
miRNATAP
TCGA BLCA -0.155; TCGA BRCA -0.226; TCGA CESC -0.296; TCGA COAD -0.517; TCGA ESCA -0.215; TCGA HNSC -0.384; TCGA LUAD -0.153; TCGA LUSC -0.361; TCGA UCEC -0.303
hsa-miR-429
PCDHGA12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.311; TCGA BRCA -0.267; TCGA CESC -0.335; TCGA COAD -0.619; TCGA ESCA -0.301; TCGA HNSC -0.538; TCGA LUAD -0.35; TCGA LUSC -0.608; TCGA OV -0.175; TCGA PAAD -0.346; TCGA PRAD -0.137; TCGA UCEC -0.284
hsa-miR-429
PCDHGC5
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.202; TCGA BRCA -0.164; TCGA CESC -0.502; TCGA ESCA -0.345; TCGA HNSC -0.598; TCGA KIRC -0.494; TCGA LUAD -0.168; TCGA LUSC -0.197; TCGA STAD -0.252; TCGA UCEC -0.254
hsa-miR-429
PCDHGB6
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.228; TCGA BRCA -0.369; TCGA CESC -0.363; TCGA COAD -0.555; TCGA ESCA -0.279; TCGA HNSC -0.351; TCGA LUAD -0.153; TCGA LUSC -0.45; TCGA PAAD -0.244; TCGA UCEC -0.3
hsa-miR-429
PCDHGB5
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; UCEC
miRNATAP
TCGA BLCA -0.175; TCGA BRCA -0.285; TCGA CESC -0.459; TCGA COAD -0.734; TCGA ESCA -0.359; TCGA HNSC -0.299; TCGA LUAD -0.175; TCGA LUSC -0.483; TCGA PRAD -0.107; TCGA UCEC -0.301
hsa-miR-429
PCDHGA9
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.253; TCGA BRCA -0.382; TCGA CESC -0.308; TCGA COAD -0.546; TCGA ESCA -0.19; TCGA HNSC -0.392; TCGA LUAD -0.218; TCGA LUSC -0.403; TCGA PAAD -0.224; TCGA PRAD -0.098; TCGA UCEC -0.305
hsa-miR-429
PCDHGA7
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; UCEC
miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.234; TCGA CESC -0.246; TCGA COAD -0.297; TCGA ESCA -0.226; TCGA HNSC -0.233; TCGA LUAD -0.194; TCGA LUSC -0.199; TCGA OV -0.189; TCGA UCEC -0.275
hsa-miR-429
PCDHGA6
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; UCEC
miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.303; TCGA CESC -0.379; TCGA COAD -0.412; TCGA ESCA -0.171; TCGA HNSC -0.278; TCGA LUAD -0.198; TCGA LUSC -0.277; TCGA UCEC -0.316
hsa-miR-429
PCDHGA5
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; UCEC
miRNATAP
TCGA BLCA -0.206; TCGA BRCA -0.363; TCGA COAD -0.489; TCGA ESCA -0.238; TCGA HNSC -0.324; TCGA LUAD -0.226; TCGA LUSC -0.214; TCGA OV -0.148; TCGA PAAD -0.17; TCGA UCEC -0.327
hsa-miR-429
PCDHGA4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.21; TCGA BRCA -0.309; TCGA CESC -0.355; TCGA COAD -0.531; TCGA ESCA -0.314; TCGA HNSC -0.283; TCGA LUAD -0.234; TCGA LUSC -0.225; TCGA PAAD -0.14; TCGA PRAD -0.097; TCGA UCEC -0.298
hsa-miR-429
PCDHGA3
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.239; TCGA BRCA -0.408; TCGA COAD -0.52; TCGA ESCA -0.235; TCGA HNSC -0.42; TCGA LUAD -0.215; TCGA LUSC -0.34; TCGA PAAD -0.153; TCGA UCEC -0.321
hsa-miR-429
PCDHGA2
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; UCEC
miRNATAP
TCGA BLCA -0.234; TCGA BRCA -0.399; TCGA COAD -0.351; TCGA ESCA -0.235; TCGA HNSC -0.404; TCGA LUAD -0.259; TCGA LUSC -0.375; TCGA PRAD -0.111; TCGA UCEC -0.421
hsa-miR-429
PCDHGB7
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.294; TCGA BRCA -0.417; TCGA CESC -0.403; TCGA COAD -0.591; TCGA ESCA -0.313; TCGA HNSC -0.453; TCGA KIRC -0.184; TCGA LUAD -0.27; TCGA LUSC -0.575; TCGA PAAD -0.223; TCGA UCEC -0.402
hsa-miR-429
ADAMTS6
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD
miRNATAP
TCGA BLCA -0.345; TCGA CESC -0.261; TCGA COAD -0.329; TCGA ESCA -0.226; TCGA HNSC -0.334; TCGA LUAD -0.128; TCGA LUSC -0.28; TCGA OV -0.145; TCGA PAAD -0.211; TCGA STAD -0.167
hsa-miR-429
WNK1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.078; TCGA BRCA -0.051; TCGA CESC -0.113; TCGA COAD -0.072; TCGA ESCA -0.09; TCGA HNSC -0.158; TCGA LUAD -0.091; TCGA PRAD -0.074; TCGA STAD -0.118; TCGA UCEC -0.071
hsa-miR-429
GAP43
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.443; TCGA BRCA -0.193; TCGA COAD -1.185; TCGA ESCA -0.51; TCGA HNSC -0.211; TCGA KIRC -0.421; TCGA LUAD -0.234; TCGA OV -0.291; TCGA PAAD -0.267; TCGA PRAD -0.13; TCGA STAD -0.604; TCGA UCEC -0.231
hsa-miR-429
SPOCK1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.237; TCGA BRCA -0.172; TCGA CESC -0.255; TCGA COAD -1.058; TCGA ESCA -0.447; TCGA HNSC -0.447; TCGA LUAD -0.242; TCGA OV -0.318; TCGA PAAD -0.341; TCGA STAD -0.451; TCGA UCEC -0.144
hsa-miR-429
ADAMTS2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.439; TCGA BRCA -0.227; TCGA CESC -0.351; TCGA COAD -0.685; TCGA ESCA -0.22; TCGA HNSC -0.488; TCGA KIRC -0.455; TCGA KIRP -0.357; TCGA LUAD -0.276; TCGA LUSC -0.455; TCGA PAAD -0.21; TCGA PRAD -0.103; TCGA UCEC -0.197
hsa-miR-429
RORA
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.147; TCGA BRCA -0.178; TCGA CESC -0.118; TCGA COAD -0.444; TCGA ESCA -0.233; TCGA HNSC -0.15; TCGA KIRC -0.077; TCGA LIHC -0.078; TCGA PAAD -0.238; TCGA STAD -0.265; TCGA UCEC -0.173
hsa-miR-429
USP13
9 cancers: BLCA; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.16; TCGA HNSC -0.159; TCGA KIRP -0.088; TCGA LIHC -0.054; TCGA LUAD -0.062; TCGA PAAD -0.078; TCGA PRAD -0.06; TCGA STAD -0.121; TCGA UCEC -0.068
hsa-miR-429
HSPG2
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.194; TCGA BRCA -0.217; TCGA CESC -0.144; TCGA COAD -0.285; TCGA HNSC -0.176; TCGA KIRC -0.235; TCGA PAAD -0.102; TCGA PRAD -0.094; TCGA STAD -0.18; TCGA UCEC -0.063
hsa-miR-429
CCDC88A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.273; TCGA BRCA -0.15; TCGA CESC -0.171; TCGA COAD -0.542; TCGA ESCA -0.166; TCGA HNSC -0.164; TCGA KIRC -0.282; TCGA KIRP -0.202; TCGA LIHC -0.079; TCGA LUAD -0.209; TCGA LUSC -0.151; TCGA PAAD -0.2; TCGA PRAD -0.087; TCGA STAD -0.202; TCGA UCEC -0.207
hsa-miR-429
IL4R
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.126; TCGA BRCA -0.068; TCGA CESC -0.212; TCGA ESCA -0.126; TCGA HNSC -0.098; TCGA KIRC -0.28; TCGA LUAD -0.054; TCGA LUSC -0.165; TCGA STAD -0.103; TCGA UCEC -0.052
hsa-miR-429
TPP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.055; TCGA CESC -0.09; TCGA COAD -0.093; TCGA ESCA -0.063; TCGA HNSC -0.194; TCGA KIRC -0.19; TCGA KIRP -0.331; TCGA LIHC -0.075; TCGA LUAD -0.112; TCGA LUSC -0.226; TCGA PAAD -0.118; TCGA UCEC -0.069
hsa-miR-429
MYO1C
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.057; TCGA BRCA -0.117; TCGA CESC -0.08; TCGA ESCA -0.066; TCGA HNSC -0.129; TCGA LUAD -0.069; TCGA LUSC -0.198; TCGA PRAD -0.067; TCGA STAD -0.082; TCGA UCEC -0.058
hsa-miR-429
GRID1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.304; TCGA CESC -0.356; TCGA COAD -0.495; TCGA ESCA -0.232; TCGA HNSC -0.265; TCGA KIRC -0.269; TCGA KIRP -0.39; TCGA LUAD -0.159; TCGA LUSC -0.455; TCGA OV -0.271; TCGA PAAD -0.178; TCGA PRAD -0.074; TCGA STAD -0.373; TCGA UCEC -0.346
hsa-miR-429
DUSP3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.163; TCGA BRCA -0.1; TCGA CESC -0.06; TCGA COAD -0.097; TCGA ESCA -0.092; TCGA HNSC -0.164; TCGA KIRP -0.177; TCGA LUAD -0.094; TCGA LUSC -0.16; TCGA PAAD -0.081; TCGA PRAD -0.066; TCGA STAD -0.193; TCGA UCEC -0.113
hsa-miR-429
SMOC2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.351; TCGA BRCA -0.168; TCGA CESC -0.212; TCGA COAD -0.237; TCGA ESCA -0.307; TCGA HNSC -0.258; TCGA LUSC -0.211; TCGA PAAD -0.272; TCGA STAD -0.535; TCGA UCEC -0.311
hsa-miR-429
ITIH3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.248; TCGA BRCA -0.352; TCGA CESC -0.322; TCGA COAD -0.702; TCGA ESCA -0.434; TCGA HNSC -0.426; TCGA LIHC -0.117; TCGA LUAD -0.16; TCGA LUSC -0.668; TCGA PAAD -0.243; TCGA STAD -0.339; TCGA UCEC -0.243
hsa-miR-429
MAFB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.252; TCGA BRCA -0.13; TCGA CESC -0.318; TCGA COAD -0.576; TCGA ESCA -0.371; TCGA HNSC -0.273; TCGA KIRC -0.189; TCGA KIRP -0.215; TCGA LIHC -0.094; TCGA LUAD -0.242; TCGA PAAD -0.305; TCGA THCA -0.067; TCGA STAD -0.205; TCGA UCEC -0.087
hsa-miR-429
RTN1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.34; TCGA BRCA -0.181; TCGA CESC -0.182; TCGA COAD -0.622; TCGA ESCA -0.314; TCGA HNSC -0.279; TCGA KIRC -0.093; TCGA KIRP -0.155; TCGA LUAD -0.241; TCGA LUSC -0.47; TCGA PAAD -0.213; TCGA STAD -0.293
hsa-miR-429
ITGA5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.424; TCGA BRCA -0.086; TCGA CESC -0.433; TCGA COAD -0.557; TCGA ESCA -0.29; TCGA HNSC -0.324; TCGA KIRC -0.5; TCGA KIRP -0.177; TCGA LUAD -0.352; TCGA LUSC -0.279; TCGA PAAD -0.246; TCGA PRAD -0.094; TCGA STAD -0.243; TCGA UCEC -0.141
hsa-miR-429
FILIP1L
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.373; TCGA BRCA -0.306; TCGA CESC -0.378; TCGA COAD -0.519; TCGA ESCA -0.262; TCGA HNSC -0.428; TCGA KIRC -0.096; TCGA LUAD -0.178; TCGA LUSC -0.429; TCGA PAAD -0.283; TCGA PRAD -0.134; TCGA THCA -0.055; TCGA STAD -0.249; TCGA UCEC -0.412
hsa-miR-429
CX3CR1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.156; TCGA BRCA -0.299; TCGA CESC -0.301; TCGA COAD -0.343; TCGA HNSC -0.415; TCGA KIRC -0.278; TCGA LUAD -0.122; TCGA LUSC -0.508; TCGA PAAD -0.211; TCGA PRAD -0.068; TCGA STAD -0.2; TCGA UCEC -0.191
hsa-miR-429
NACC2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD
miRNATAP
TCGA BLCA -0.237; TCGA BRCA -0.089; TCGA COAD -0.138; TCGA ESCA -0.12; TCGA HNSC -0.06; TCGA KIRP -0.171; TCGA LUAD -0.098; TCGA LUSC -0.095; TCGA PRAD -0.103; TCGA STAD -0.264
hsa-miR-429
OSBPL6
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; OV; THCA; STAD
miRNATAP
TCGA BLCA -0.542; TCGA BRCA -0.086; TCGA CESC -0.199; TCGA COAD -0.36; TCGA ESCA -0.602; TCGA HNSC -0.083; TCGA KIRP -0.403; TCGA LUSC -0.2; TCGA OV -0.252; TCGA THCA -0.074; TCGA STAD -0.308
hsa-miR-429
APBB1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.329; TCGA BRCA -0.099; TCGA CESC -0.179; TCGA COAD -0.498; TCGA ESCA -0.321; TCGA HNSC -0.271; TCGA LIHC -0.053; TCGA LUSC -0.359; TCGA OV -0.114; TCGA PAAD -0.13; TCGA STAD -0.386; TCGA UCEC -0.372
hsa-miR-429
NLGN1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.257; TCGA BRCA -0.536; TCGA COAD -1.051; TCGA ESCA -0.485; TCGA KIRC -0.262; TCGA KIRP -0.412; TCGA OV -0.243; TCGA PRAD -0.098; TCGA STAD -0.65; TCGA UCEC -0.421
hsa-miR-429
PLXNC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.371; TCGA BRCA -0.192; TCGA CESC -0.312; TCGA COAD -0.671; TCGA ESCA -0.234; TCGA HNSC -0.578; TCGA KIRC -0.338; TCGA KIRP -0.419; TCGA LUAD -0.244; TCGA LUSC -0.657; TCGA PAAD -0.331; TCGA PRAD -0.13; TCGA STAD -0.098; TCGA UCEC -0.261
hsa-miR-429
SLC24A3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.354; TCGA BRCA -0.124; TCGA CESC -0.456; TCGA COAD -0.563; TCGA ESCA -0.267; TCGA HNSC -0.392; TCGA LUSC -0.287; TCGA PRAD -0.072; TCGA STAD -0.231; TCGA UCEC -0.401
hsa-miR-429
CEP170
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.114; TCGA CESC -0.093; TCGA COAD -0.288; TCGA ESCA -0.11; TCGA HNSC -0.184; TCGA KIRC -0.265; TCGA KIRP -0.167; TCGA LUAD -0.098; TCGA LUSC -0.122; TCGA OV -0.07; TCGA PAAD -0.196; TCGA STAD -0.111; TCGA UCEC -0.087
hsa-miR-429
DPYSL2
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.299; TCGA BRCA -0.226; TCGA COAD -0.117; TCGA HNSC -0.181; TCGA KIRC -0.179; TCGA KIRP -0.078; TCGA LUSC -0.407; TCGA OV -0.224; TCGA PAAD -0.069; TCGA PRAD -0.098; TCGA STAD -0.171; TCGA UCEC -0.276
hsa-miR-429
IGFBP5
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.368; TCGA BRCA -0.189; TCGA CESC -0.184; TCGA COAD -0.647; TCGA ESCA -0.235; TCGA HNSC -0.258; TCGA PAAD -0.27; TCGA STAD -0.278; TCGA UCEC -0.294
hsa-miR-429
FJX1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD
miRNATAP
TCGA BLCA -0.109; TCGA CESC -0.206; TCGA COAD -0.194; TCGA ESCA -0.188; TCGA HNSC -0.134; TCGA KIRC -0.336; TCGA KIRP -0.225; TCGA LUAD -0.214; TCGA PAAD -0.111
hsa-miR-429
RAB9B
9 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.211; TCGA BRCA -0.19; TCGA ESCA -0.395; TCGA KIRC -0.199; TCGA KIRP -0.359; TCGA PAAD -0.242; TCGA PRAD -0.197; TCGA STAD -0.528; TCGA UCEC -0.346
hsa-miR-429
CD69
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.355; TCGA BRCA -0.178; TCGA CESC -0.277; TCGA COAD -0.387; TCGA ESCA -0.219; TCGA HNSC -0.293; TCGA KIRC -0.299; TCGA LUAD -0.227; TCGA LUSC -0.555; TCGA PAAD -0.524; TCGA PRAD -0.1; TCGA STAD -0.147
hsa-miR-429
BACE1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.183; TCGA BRCA -0.141; TCGA CESC -0.079; TCGA COAD -0.207; TCGA ESCA -0.16; TCGA HNSC -0.178; TCGA LUAD -0.132; TCGA LUSC -0.122; TCGA PAAD -0.11; TCGA PRAD -0.05; TCGA STAD -0.196; TCGA UCEC -0.094
hsa-miR-429
LMOD1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.474; TCGA BRCA -0.447; TCGA CESC -0.403; TCGA COAD -1.008; TCGA ESCA -0.623; TCGA HNSC -0.398; TCGA LIHC -0.076; TCGA LUAD -0.123; TCGA LUSC -0.564; TCGA OV -0.176; TCGA PAAD -0.341; TCGA PRAD -0.111; TCGA STAD -0.76; TCGA UCEC -0.608
hsa-miR-429
JAKMIP1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.334; TCGA CESC -0.323; TCGA COAD -0.492; TCGA ESCA -0.228; TCGA HNSC -0.201; TCGA KIRC -0.721; TCGA KIRP -0.408; TCGA LUAD -0.119; TCGA LUSC -0.416; TCGA PAAD -0.391; TCGA PRAD -0.127; TCGA THCA -0.075; TCGA STAD -0.131
hsa-miR-429
ARHGAP1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.122; TCGA CESC -0.062; TCGA COAD -0.083; TCGA ESCA -0.082; TCGA HNSC -0.16; TCGA KIRC -0.102; TCGA KIRP -0.084; TCGA PRAD -0.06; TCGA STAD -0.098; TCGA UCEC -0.053
hsa-miR-429
FBXO10
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA
miRNATAP
TCGA BLCA -0.13; TCGA CESC -0.062; TCGA COAD -0.09; TCGA ESCA -0.12; TCGA HNSC -0.271; TCGA KIRP -0.12; TCGA LUAD -0.112; TCGA LUSC -0.17; TCGA PAAD -0.242; TCGA THCA -0.063
hsa-miR-429
SCN4B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.199; TCGA BRCA -0.487; TCGA CESC -0.413; TCGA COAD -0.562; TCGA ESCA -0.346; TCGA HNSC -0.312; TCGA KIRC -0.339; TCGA KIRP -0.186; TCGA LIHC -0.115; TCGA LUSC -0.33; TCGA OV -0.124; TCGA PAAD -0.211; TCGA PRAD -0.124; TCGA STAD -0.369; TCGA UCEC -0.433
hsa-miR-429
RCSD1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.372; TCGA BRCA -0.145; TCGA CESC -0.289; TCGA COAD -0.373; TCGA ESCA -0.21; TCGA HNSC -0.377; TCGA KIRC -0.273; TCGA KIRP -0.156; TCGA LUAD -0.217; TCGA LUSC -0.518; TCGA PAAD -0.532; TCGA PRAD -0.081; TCGA STAD -0.209; TCGA UCEC -0.151
hsa-miR-429
LHX6
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.157; TCGA BRCA -0.27; TCGA CESC -0.19; TCGA COAD -0.413; TCGA ESCA -0.153; TCGA KIRC -0.243; TCGA LUAD -0.158; TCGA PAAD -0.209; TCGA STAD -0.188; TCGA UCEC -0.156
hsa-miR-429
CD163
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.582; TCGA BRCA -0.125; TCGA CESC -0.424; TCGA COAD -0.707; TCGA ESCA -0.338; TCGA HNSC -0.484; TCGA KIRC -0.458; TCGA KIRP -0.429; TCGA LUAD -0.435; TCGA LUSC -0.671; TCGA PAAD -0.623; TCGA PRAD -0.124; TCGA THCA -0.08; TCGA STAD -0.149
hsa-miR-429
CD72
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD
miRNATAP
TCGA BLCA -0.227; TCGA CESC -0.214; TCGA COAD -0.372; TCGA ESCA -0.178; TCGA HNSC -0.18; TCGA KIRC -0.486; TCGA LUAD -0.13; TCGA LUSC -0.337; TCGA PAAD -0.513
hsa-miR-429
GYG1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.071; TCGA CESC -0.078; TCGA ESCA -0.12; TCGA HNSC -0.149; TCGA KIRP -0.072; TCGA LUAD -0.054; TCGA PAAD -0.057; TCGA STAD -0.195; TCGA UCEC -0.064
hsa-miR-429
NEURL1B
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.217; TCGA BRCA -0.074; TCGA CESC -0.099; TCGA ESCA -0.112; TCGA KIRC -0.223; TCGA LUSC -0.134; TCGA PRAD -0.096; TCGA STAD -0.168; TCGA UCEC -0.165
hsa-miR-429
DIP2C
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.125; TCGA COAD -0.307; TCGA ESCA -0.15; TCGA HNSC -0.166; TCGA LUSC -0.084; TCGA PAAD -0.103; TCGA THCA -0.054; TCGA STAD -0.243; TCGA UCEC -0.165
hsa-miR-429
KCNN3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.278; TCGA BRCA -0.151; TCGA CESC -0.412; TCGA COAD -0.513; TCGA ESCA -0.158; TCGA HNSC -0.238; TCGA LUAD -0.1; TCGA LUSC -0.326; TCGA OV -0.145; TCGA PAAD -0.336; TCGA PRAD -0.173; TCGA STAD -0.317; TCGA UCEC -0.074
hsa-miR-429
FMNL3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.121; TCGA CESC -0.116; TCGA COAD -0.216; TCGA ESCA -0.122; TCGA HNSC -0.2; TCGA KIRC -0.262; TCGA KIRP -0.094; TCGA LUAD -0.16; TCGA LUSC -0.253; TCGA PAAD -0.267; TCGA STAD -0.118; TCGA UCEC -0.134
hsa-miR-429
PRKG1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.412; TCGA BRCA -0.346; TCGA CESC -0.302; TCGA COAD -0.486; TCGA ESCA -0.222; TCGA HNSC -0.564; TCGA LUAD -0.342; TCGA LUSC -0.593; TCGA OV -0.161; TCGA PAAD -0.262; TCGA PRAD -0.217; TCGA STAD -0.361; TCGA UCEC -0.451
hsa-miR-429
SLIT3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.413; TCGA CESC -0.248; TCGA COAD -0.79; TCGA ESCA -0.349; TCGA HNSC -0.347; TCGA LUAD -0.275; TCGA LUSC -0.605; TCGA OV -0.165; TCGA PAAD -0.455; TCGA PRAD -0.18; TCGA STAD -0.396; TCGA UCEC -0.179
hsa-miR-429
PRICKLE2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.269; TCGA BRCA -0.26; TCGA CESC -0.193; TCGA COAD -0.468; TCGA ESCA -0.347; TCGA HNSC -0.214; TCGA LUSC -0.295; TCGA PAAD -0.248; TCGA PRAD -0.079; TCGA STAD -0.522; TCGA UCEC -0.246
hsa-miR-429
FAM46B
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.43; TCGA CESC -0.181; TCGA COAD -0.55; TCGA ESCA -0.336; TCGA HNSC -0.153; TCGA LUAD -0.138; TCGA LUSC -0.22; TCGA PAAD -0.132; TCGA PRAD -0.106; TCGA STAD -0.511
hsa-miR-429
CSMD2
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.178; TCGA COAD -0.545; TCGA ESCA -0.235; TCGA HNSC -0.411; TCGA KIRC -0.291; TCGA LUAD -0.22; TCGA LUSC -0.145; TCGA PAAD -0.263; TCGA STAD -0.092
hsa-miR-429
DISC1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; OV; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.119; TCGA BRCA -0.144; TCGA COAD -0.152; TCGA ESCA -0.128; TCGA KIRC -0.342; TCGA KIRP -0.168; TCGA OV -0.086; TCGA PAAD -0.148; TCGA PRAD -0.066; TCGA STAD -0.056
hsa-miR-429
MCAM
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.256; TCGA BRCA -0.298; TCGA CESC -0.348; TCGA COAD -0.346; TCGA ESCA -0.234; TCGA HNSC -0.182; TCGA KIRC -0.45; TCGA LUAD -0.228; TCGA LUSC -0.198; TCGA PAAD -0.213; TCGA PRAD -0.133; TCGA STAD -0.335; TCGA UCEC -0.205
hsa-miR-429
MDGA1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.322; TCGA BRCA -0.129; TCGA CESC -0.176; TCGA COAD -0.54; TCGA ESCA -0.349; TCGA HNSC -0.13; TCGA LUAD -0.313; TCGA PAAD -0.369; TCGA STAD -0.296; TCGA UCEC -0.309
hsa-miR-429
PXDN
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.298; TCGA BRCA -0.069; TCGA CESC -0.218; TCGA COAD -0.471; TCGA ESCA -0.13; TCGA HNSC -0.279; TCGA KIRC -0.424; TCGA LUAD -0.144; TCGA PAAD -0.197; TCGA STAD -0.102; TCGA UCEC -0.197
hsa-miR-429
XYLT1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.205; TCGA BRCA -0.201; TCGA CESC -0.17; TCGA COAD -0.088; TCGA HNSC -0.302; TCGA KIRC -0.11; TCGA LUSC -0.332; TCGA PAAD -0.128; TCGA STAD -0.103; TCGA UCEC -0.376
hsa-miR-429
STIM1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; STAD
miRNATAP
TCGA BLCA -0.084; TCGA CESC -0.068; TCGA COAD -0.062; TCGA ESCA -0.124; TCGA HNSC -0.096; TCGA KIRC -0.082; TCGA KIRP -0.134; TCGA LIHC -0.063; TCGA PRAD -0.051; TCGA STAD -0.101
hsa-miR-429
ACVRL1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.195; TCGA BRCA -0.218; TCGA CESC -0.274; TCGA ESCA -0.095; TCGA HNSC -0.268; TCGA KIRC -0.171; TCGA LUAD -0.249; TCGA LUSC -0.474; TCGA PAAD -0.212; TCGA PRAD -0.058; TCGA STAD -0.072; TCGA UCEC -0.163
hsa-miR-429
PRNP
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.285; TCGA BRCA -0.202; TCGA CESC -0.406; TCGA COAD -0.402; TCGA ESCA -0.326; TCGA HNSC -0.173; TCGA KIRP -0.094; TCGA LUAD -0.192; TCGA PAAD -0.198; TCGA PRAD -0.091; TCGA STAD -0.299; TCGA UCEC -0.366
hsa-miR-429
RRAGD
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.182; TCGA BRCA -0.219; TCGA COAD -0.361; TCGA ESCA -0.306; TCGA HNSC -0.101; TCGA KIRP -0.34; TCGA LIHC -0.102; TCGA PAAD -0.211; TCGA THCA -0.099; TCGA STAD -0.214
hsa-miR-429
NFE2L1
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; STAD; UCEC
miRNATAP
TCGA BLCA -0.073; TCGA BRCA -0.07; TCGA CESC -0.107; TCGA ESCA -0.111; TCGA HNSC -0.124; TCGA KIRP -0.064; TCGA LIHC -0.086; TCGA STAD -0.062; TCGA UCEC -0.089
hsa-miR-429
ZC3H12C
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.073; TCGA BRCA -0.249; TCGA CESC -0.171; TCGA ESCA -0.145; TCGA HNSC -0.194; TCGA KIRP -0.13; TCGA LUAD -0.117; TCGA LUSC -0.133; TCGA OV -0.101; TCGA PAAD -0.106; TCGA STAD -0.148; TCGA UCEC -0.205
hsa-miR-429
STX1B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.347; TCGA BRCA -0.14; TCGA CESC -0.383; TCGA COAD -0.288; TCGA ESCA -0.239; TCGA HNSC -0.186; TCGA KIRC -0.251; TCGA LIHC -0.131; TCGA LUAD -0.121; TCGA LUSC -0.134; TCGA PAAD -0.164; TCGA STAD -0.25; TCGA UCEC -0.31
hsa-miR-429
SCN1B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.414; TCGA BRCA -0.109; TCGA CESC -0.212; TCGA COAD -0.446; TCGA ESCA -0.233; TCGA HNSC -0.432; TCGA KIRC -0.347; TCGA KIRP -0.311; TCGA LUSC -0.237; TCGA PAAD -0.122; TCGA STAD -0.229; TCGA UCEC -0.199
hsa-miR-429
RHOB
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.087; TCGA CESC -0.117; TCGA COAD -0.157; TCGA ESCA -0.189; TCGA HNSC -0.18; TCGA KIRC -0.136; TCGA LIHC -0.062; TCGA LUSC -0.167; TCGA PRAD -0.075; TCGA STAD -0.314; TCGA UCEC -0.122
hsa-miR-429
GAB2
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.101; TCGA HNSC -0.198; TCGA KIRC -0.118; TCGA KIRP -0.126; TCGA LUSC -0.382; TCGA PAAD -0.104; TCGA PRAD -0.063; TCGA STAD -0.081; TCGA UCEC -0.206
hsa-miR-429
MAP3K12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.095; TCGA BRCA -0.07; TCGA CESC -0.133; TCGA COAD -0.469; TCGA ESCA -0.256; TCGA HNSC -0.147; TCGA KIRC -0.253; TCGA LUAD -0.08; TCGA LUSC -0.195; TCGA PAAD -0.157; TCGA STAD -0.078; TCGA UCEC -0.207
hsa-miR-429
TSPYL2
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; STAD; UCEC
miRNATAP
TCGA BLCA -0.05; TCGA BRCA -0.108; TCGA CESC -0.078; TCGA COAD -0.183; TCGA ESCA -0.167; TCGA KIRC -0.185; TCGA LIHC -0.052; TCGA STAD -0.315; TCGA UCEC -0.17
hsa-miR-429
ITGA11
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.317; TCGA BRCA -0.1; TCGA CESC -0.361; TCGA COAD -0.645; TCGA ESCA -0.223; TCGA HNSC -0.455; TCGA KIRP -0.237; TCGA LUAD -0.124; TCGA LUSC -0.236; TCGA PAAD -0.211; TCGA STAD -0.093; TCGA UCEC -0.305
hsa-miR-429
FAP
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.467; TCGA CESC -0.507; TCGA COAD -0.816; TCGA ESCA -0.325; TCGA HNSC -0.459; TCGA KIRC -0.693; TCGA KIRP -0.278; TCGA LUAD -0.249; TCGA LUSC -0.3; TCGA PAAD -0.226; TCGA STAD -0.155; TCGA UCEC -0.249
hsa-miR-429
ADAMTS10
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.258; TCGA BRCA -0.153; TCGA CESC -0.312; TCGA COAD -0.595; TCGA ESCA -0.284; TCGA HNSC -0.222; TCGA KIRC -0.371; TCGA LUSC -0.351; TCGA OV -0.158; TCGA PAAD -0.186; TCGA STAD -0.257; TCGA UCEC -0.291
hsa-miR-429
HABP4
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.189; TCGA BRCA -0.177; TCGA COAD -0.091; TCGA ESCA -0.098; TCGA HNSC -0.144; TCGA KIRP -0.174; TCGA LIHC -0.111; TCGA LUSC -0.191; TCGA PAAD -0.059; TCGA STAD -0.177; TCGA UCEC -0.138
hsa-miR-429
FOXJ2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.062; TCGA CESC -0.09; TCGA COAD -0.062; TCGA ESCA -0.077; TCGA HNSC -0.061; TCGA KIRC -0.102; TCGA LUAD -0.061; TCGA STAD -0.095; TCGA UCEC -0.17
hsa-miR-429
CHST3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.282; TCGA BRCA -0.218; TCGA CESC -0.255; TCGA COAD -0.513; TCGA ESCA -0.328; TCGA HNSC -0.152; TCGA LUAD -0.189; TCGA PAAD -0.174; TCGA PRAD -0.082; TCGA STAD -0.293; TCGA UCEC -0.112
hsa-miR-429
SNX18
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.069; TCGA BRCA -0.133; TCGA CESC -0.063; TCGA COAD -0.227; TCGA ESCA -0.083; TCGA HNSC -0.075; TCGA LUAD -0.05; TCGA LUSC -0.055; TCGA OV -0.06; TCGA PAAD -0.144; TCGA STAD -0.102; TCGA UCEC -0.126
hsa-miR-429
NFIC
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.222; TCGA BRCA -0.084; TCGA COAD -0.236; TCGA ESCA -0.141; TCGA HNSC -0.269; TCGA LIHC -0.068; TCGA LUAD -0.088; TCGA LUSC -0.123; TCGA STAD -0.201; TCGA UCEC -0.07
hsa-miR-429
IFNGR1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.145; TCGA CESC -0.133; TCGA HNSC -0.05; TCGA KIRC -0.144; TCGA KIRP -0.062; TCGA LIHC -0.059; TCGA LUAD -0.111; TCGA LUSC -0.067; TCGA PAAD -0.172; TCGA UCEC -0.087
hsa-miR-429
PRUNE2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.701; TCGA BRCA -0.311; TCGA CESC -0.249; TCGA COAD -0.203; TCGA ESCA -0.486; TCGA HNSC -0.694; TCGA KIRC -0.2; TCGA KIRP -0.325; TCGA LUSC -0.382; TCGA PAAD -0.223; TCGA STAD -0.704; TCGA UCEC -0.445
hsa-miR-429
DUSP5
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.091; TCGA CESC -0.169; TCGA COAD -0.216; TCGA ESCA -0.182; TCGA HNSC -0.077; TCGA LUAD -0.097; TCGA LUSC -0.23; TCGA STAD -0.127; TCGA UCEC -0.118
hsa-miR-429
ARHGAP25
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.136; TCGA CESC -0.345; TCGA COAD -0.364; TCGA ESCA -0.163; TCGA HNSC -0.212; TCGA KIRC -0.35; TCGA KIRP -0.131; TCGA LUAD -0.159; TCGA LUSC -0.27; TCGA PAAD -0.437; TCGA UCEC -0.17
hsa-miR-429
AKAP13
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.114; TCGA CESC -0.066; TCGA COAD -0.082; TCGA HNSC -0.146; TCGA KIRC -0.132; TCGA LUSC -0.221; TCGA PAAD -0.14; TCGA UCEC -0.132
hsa-miR-429
NLGN2
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.087; TCGA CESC -0.12; TCGA COAD -0.417; TCGA ESCA -0.322; TCGA HNSC -0.092; TCGA KIRC -0.118; TCGA PAAD -0.198; TCGA STAD -0.285; TCGA UCEC -0.21
hsa-miR-429
AGPAT4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.209; TCGA BRCA -0.138; TCGA CESC -0.186; TCGA COAD -0.395; TCGA ESCA -0.171; TCGA HNSC -0.158; TCGA LUAD -0.109; TCGA LUSC -0.151; TCGA PAAD -0.131; TCGA STAD -0.187; TCGA UCEC -0.074
hsa-miR-429
TNFRSF1B
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.225; TCGA BRCA -0.182; TCGA CESC -0.205; TCGA HNSC -0.256; TCGA KIRC -0.294; TCGA KIRP -0.175; TCGA LUAD -0.154; TCGA LUSC -0.424; TCGA PAAD -0.271; TCGA UCEC -0.134
hsa-miR-429
MXRA7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.248; TCGA BRCA -0.211; TCGA CESC -0.164; TCGA COAD -0.445; TCGA ESCA -0.276; TCGA KIRC -0.113; TCGA KIRP -0.105; TCGA LUAD -0.184; TCGA PAAD -0.155; TCGA PRAD -0.101; TCGA STAD -0.364; TCGA UCEC -0.195
hsa-miR-429
FNDC4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.252; TCGA CESC -0.281; TCGA COAD -0.483; TCGA ESCA -0.146; TCGA HNSC -0.188; TCGA LIHC -0.072; TCGA OV -0.128; TCGA PRAD -0.062; TCGA STAD -0.155; TCGA UCEC -0.213
hsa-miR-429
WBSCR17
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.551; TCGA BRCA -0.237; TCGA CESC -0.214; TCGA COAD -0.567; TCGA ESCA -0.338; TCGA HNSC -0.367; TCGA LUSC -0.445; TCGA PAAD -0.321; TCGA PRAD -0.095; TCGA STAD -0.333; TCGA UCEC -0.406
hsa-miR-429
MARCH2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; STAD
miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.055; TCGA CESC -0.085; TCGA COAD -0.167; TCGA ESCA -0.108; TCGA HNSC -0.089; TCGA KIRC -0.086; TCGA LIHC -0.074; TCGA LUSC -0.151; TCGA STAD -0.17
hsa-miR-429
ATP1B2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.113; TCGA BRCA -0.292; TCGA CESC -0.235; TCGA COAD -0.584; TCGA ESCA -0.395; TCGA HNSC -0.175; TCGA LUSC -0.259; TCGA PRAD -0.13; TCGA STAD -0.491; TCGA UCEC -0.375
hsa-miR-429
SFRP1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.528; TCGA BRCA -0.483; TCGA CESC -0.634; TCGA COAD -1.247; TCGA ESCA -0.673; TCGA HNSC -0.627; TCGA LUSC -0.375; TCGA PAAD -0.463; TCGA STAD -0.766; TCGA UCEC -0.428
hsa-miR-429
FGL2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.551; TCGA BRCA -0.291; TCGA CESC -0.378; TCGA COAD -0.454; TCGA ESCA -0.498; TCGA HNSC -0.447; TCGA LUAD -0.285; TCGA LUSC -0.54; TCGA PAAD -0.455; TCGA PRAD -0.084; TCGA STAD -0.465; TCGA UCEC -0.281
hsa-miR-429
CYP2U1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.132; TCGA BRCA -0.263; TCGA CESC -0.129; TCGA COAD -0.198; TCGA ESCA -0.129; TCGA HNSC -0.2; TCGA KIRP -0.205; TCGA LIHC -0.148; TCGA LUAD -0.086; TCGA LUSC -0.281; TCGA OV -0.065; TCGA PAAD -0.245; TCGA PRAD -0.094; TCGA STAD -0.25; TCGA UCEC -0.224
hsa-miR-429
JAM2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.34; TCGA BRCA -0.404; TCGA CESC -0.358; TCGA COAD -0.822; TCGA ESCA -0.327; TCGA HNSC -0.425; TCGA LUAD -0.219; TCGA LUSC -0.547; TCGA OV -0.219; TCGA PAAD -0.345; TCGA PRAD -0.114; TCGA STAD -0.43; TCGA UCEC -0.376
hsa-miR-429
NFIX
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.291; TCGA BRCA -0.13; TCGA CESC -0.161; TCGA COAD -0.073; TCGA HNSC -0.147; TCGA KIRC -0.2; TCGA KIRP -0.17; TCGA LIHC -0.05; TCGA LUSC -0.097; TCGA OV -0.084; TCGA PAAD -0.098; TCGA STAD -0.178; TCGA UCEC -0.139
hsa-miR-429
APCDD1L
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.729; TCGA BRCA -0.223; TCGA CESC -0.565; TCGA COAD -0.975; TCGA ESCA -0.546; TCGA HNSC -0.443; TCGA LUAD -0.225; TCGA STAD -0.335; TCGA UCEC -0.148
hsa-miR-429
NAV1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; OV; PRAD; STAD
miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.123; TCGA CESC -0.104; TCGA COAD -0.276; TCGA ESCA -0.192; TCGA HNSC -0.107; TCGA KIRC -0.221; TCGA OV -0.088; TCGA PRAD -0.093; TCGA STAD -0.081
hsa-miR-429
RAB11FIP5
9 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.102; TCGA CESC -0.166; TCGA COAD -0.062; TCGA HNSC -0.148; TCGA LUAD -0.089; TCGA LUSC -0.09; TCGA PAAD -0.089; TCGA STAD -0.075; TCGA UCEC -0.178
hsa-miR-429
GAS7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.429; TCGA BRCA -0.293; TCGA CESC -0.33; TCGA COAD -0.613; TCGA ESCA -0.354; TCGA HNSC -0.361; TCGA KIRC -0.156; TCGA KIRP -0.193; TCGA LUAD -0.203; TCGA LUSC -0.547; TCGA OV -0.104; TCGA PAAD -0.392; TCGA PRAD -0.082; TCGA STAD -0.359; TCGA UCEC -0.187
hsa-miR-429
FGF7
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.444; TCGA BRCA -0.366; TCGA CESC -0.39; TCGA COAD -0.774; TCGA ESCA -0.403; TCGA HNSC -0.456; TCGA LUAD -0.236; TCGA LUSC -0.452; TCGA OV -0.245; TCGA PAAD -0.411; TCGA PRAD -0.204; TCGA STAD -0.443; TCGA UCEC -0.476
hsa-miR-429
SEPT6
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.244; TCGA CESC -0.098; TCGA COAD -0.218; TCGA ESCA -0.199; TCGA HNSC -0.179; TCGA LUAD -0.08; TCGA LUSC -0.283; TCGA PAAD -0.327; TCGA STAD -0.231
hsa-miR-429
DTX1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD
miRNATAP
TCGA BLCA -0.313; TCGA BRCA -0.369; TCGA COAD -0.146; TCGA ESCA -0.183; TCGA HNSC -0.183; TCGA LUSC -0.161; TCGA OV -0.12; TCGA PAAD -0.255; TCGA STAD -0.154
hsa-miR-429
LIMS2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.351; TCGA BRCA -0.301; TCGA CESC -0.281; TCGA COAD -0.482; TCGA ESCA -0.347; TCGA HNSC -0.164; TCGA LIHC -0.068; TCGA LUAD -0.145; TCGA LUSC -0.457; TCGA OV -0.096; TCGA PAAD -0.214; TCGA PRAD -0.081; TCGA STAD -0.532; TCGA UCEC -0.288
hsa-miR-429
F8
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.245; TCGA BRCA -0.255; TCGA CESC -0.099; TCGA COAD -0.356; TCGA ESCA -0.28; TCGA HNSC -0.191; TCGA KIRC -0.175; TCGA KIRP -0.099; TCGA LIHC -0.094; TCGA LUAD -0.114; TCGA LUSC -0.355; TCGA PAAD -0.229; TCGA PRAD -0.079; TCGA STAD -0.304; TCGA UCEC -0.282
hsa-miR-429
PNRC1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.108; TCGA CESC -0.148; TCGA COAD -0.109; TCGA ESCA -0.205; TCGA HNSC -0.154; TCGA KIRC -0.166; TCGA KIRP -0.113; TCGA LUAD -0.12; TCGA LUSC -0.136; TCGA PAAD -0.126; TCGA STAD -0.155; TCGA UCEC -0.137
hsa-miR-429
NRXN2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.381; TCGA BRCA -0.152; TCGA CESC -0.227; TCGA COAD -0.454; TCGA ESCA -0.427; TCGA HNSC -0.222; TCGA KIRC -0.308; TCGA KIRP -0.229; TCGA LUSC -0.185; TCGA PAAD -0.202; TCGA THCA -0.087; TCGA STAD -0.5; TCGA UCEC -0.335
hsa-miR-429
MYADM
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.409; TCGA BRCA -0.166; TCGA CESC -0.171; TCGA COAD -0.264; TCGA ESCA -0.165; TCGA HNSC -0.298; TCGA KIRC -0.198; TCGA LUAD -0.231; TCGA LUSC -0.562; TCGA PAAD -0.092; TCGA PRAD -0.11; TCGA STAD -0.226; TCGA UCEC -0.229
hsa-miR-429
SEPT4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.173; TCGA BRCA -0.16; TCGA CESC -0.348; TCGA COAD -0.384; TCGA ESCA -0.202; TCGA HNSC -0.27; TCGA KIRC -0.249; TCGA LIHC -0.218; TCGA LUAD -0.109; TCGA LUSC -0.384; TCGA PAAD -0.243; TCGA STAD -0.216; TCGA UCEC -0.149
hsa-miR-429
MITF
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.305; TCGA BRCA -0.269; TCGA CESC -0.152; TCGA COAD -0.665; TCGA ESCA -0.22; TCGA HNSC -0.357; TCGA LUAD -0.178; TCGA LUSC -0.461; TCGA PAAD -0.204; TCGA PRAD -0.096; TCGA STAD -0.272; TCGA UCEC -0.28
hsa-miR-429
ENPP6
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
miRNATAP
TCGA BLCA -0.259; TCGA BRCA -0.206; TCGA CESC -0.296; TCGA COAD -0.276; TCGA ESCA -0.295; TCGA HNSC -0.207; TCGA LUAD -0.184; TCGA LUSC -0.293; TCGA PAAD -0.424; TCGA STAD -0.148
hsa-miR-429
IGLON5
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; OV; STAD
miRNATAP
TCGA BLCA -0.181; TCGA BRCA -0.117; TCGA COAD -0.494; TCGA ESCA -0.235; TCGA HNSC -0.137; TCGA KIRC -0.729; TCGA KIRP -0.507; TCGA OV -0.324; TCGA STAD -0.263
hsa-miR-429
GNAI2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.084; TCGA CESC -0.111; TCGA COAD -0.201; TCGA ESCA -0.118; TCGA HNSC -0.185; TCGA KIRC -0.17; TCGA LUAD -0.123; TCGA LUSC -0.217; TCGA PAAD -0.054; TCGA STAD -0.107; TCGA UCEC -0.056
hsa-miR-429
RCAN2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.255; TCGA BRCA -0.268; TCGA CESC -0.261; TCGA COAD -0.423; TCGA ESCA -0.269; TCGA HNSC -0.478; TCGA LUSC -0.418; TCGA PAAD -0.179; TCGA PRAD -0.114; TCGA THCA -0.091; TCGA STAD -0.376; TCGA UCEC -0.304
hsa-miR-429
SLCO2A1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.178; TCGA BRCA -0.144; TCGA CESC -0.367; TCGA COAD -0.351; TCGA HNSC -0.237; TCGA LUAD -0.119; TCGA LUSC -0.528; TCGA PAAD -0.164; TCGA STAD -0.137; TCGA UCEC -0.151
hsa-miR-429
SEMA3D
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; OV; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.136; TCGA BRCA -0.516; TCGA COAD -1.012; TCGA ESCA -0.51; TCGA LUAD -0.269; TCGA OV -0.375; TCGA PAAD -0.592; TCGA PRAD -0.128; TCGA STAD -0.344
hsa-miR-429
DPF3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.367; TCGA BRCA -0.16; TCGA CESC -0.219; TCGA ESCA -0.287; TCGA HNSC -0.52; TCGA LIHC -0.096; TCGA LUAD -0.154; TCGA LUSC -0.278; TCGA PAAD -0.298; TCGA STAD -0.1; TCGA UCEC -0.116
hsa-miR-429
BTLA
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.316; TCGA BRCA -0.088; TCGA CESC -0.251; TCGA COAD -0.354; TCGA HNSC -0.238; TCGA KIRC -0.28; TCGA LUAD -0.125; TCGA LUSC -0.424; TCGA PAAD -0.697; TCGA UCEC -0.094
hsa-miR-429
PEA15
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.09; TCGA CESC -0.096; TCGA COAD -0.203; TCGA ESCA -0.106; TCGA HNSC -0.155; TCGA KIRC -0.151; TCGA KIRP -0.11; TCGA LUAD -0.108; TCGA LUSC -0.211; TCGA PAAD -0.122; TCGA PRAD -0.072; TCGA STAD -0.154
hsa-miR-429
EDN1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.139; TCGA BRCA -0.158; TCGA CESC -0.177; TCGA COAD -0.165; TCGA HNSC -0.134; TCGA KIRC -0.273; TCGA LUAD -0.163; TCGA LUSC -0.212; TCGA PAAD -0.138; TCGA UCEC -0.102
hsa-miR-429
SLC25A43
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; UCEC
miRNATAP
TCGA BLCA -0.06; TCGA CESC -0.134; TCGA HNSC -0.182; TCGA KIRC -0.24; TCGA KIRP -0.181; TCGA LIHC -0.068; TCGA LUAD -0.11; TCGA LUSC -0.062; TCGA UCEC -0.059
hsa-miR-429
NUDT10
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.381; TCGA BRCA -0.184; TCGA CESC -0.285; TCGA COAD -0.824; TCGA ESCA -0.568; TCGA LUAD -0.213; TCGA OV -0.286; TCGA PAAD -0.388; TCGA STAD -0.554; TCGA UCEC -0.44
hsa-miR-429
SH2B3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.232; TCGA BRCA -0.152; TCGA CESC -0.195; TCGA COAD -0.169; TCGA HNSC -0.268; TCGA KIRC -0.322; TCGA LUAD -0.215; TCGA LUSC -0.377; TCGA PAAD -0.234; TCGA STAD -0.05; TCGA UCEC -0.156
hsa-miR-429
PER1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.273; TCGA BRCA -0.276; TCGA CESC -0.206; TCGA COAD -0.288; TCGA ESCA -0.296; TCGA HNSC -0.092; TCGA LUSC -0.216; TCGA PAAD -0.132; TCGA STAD -0.304; TCGA UCEC -0.22
hsa-miR-429
TNFAIP8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.088; TCGA BRCA -0.154; TCGA CESC -0.134; TCGA COAD -0.12; TCGA ESCA -0.164; TCGA KIRC -0.137; TCGA LUAD -0.096; TCGA LUSC -0.099; TCGA PAAD -0.218; TCGA PRAD -0.189; TCGA THCA -0.051; TCGA STAD -0.139; TCGA UCEC -0.093
hsa-miR-429
KCTD20
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.092; TCGA BRCA -0.117; TCGA COAD -0.063; TCGA HNSC -0.121; TCGA KIRC -0.129; TCGA KIRP -0.135; TCGA LUAD -0.094; TCGA LUSC -0.109; TCGA PAAD -0.206; TCGA STAD -0.119; TCGA UCEC -0.134
hsa-miR-429
ANTXR2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.312; TCGA BRCA -0.333; TCGA CESC -0.347; TCGA COAD -0.242; TCGA ESCA -0.104; TCGA HNSC -0.337; TCGA KIRC -0.149; TCGA LUAD -0.119; TCGA LUSC -0.307; TCGA PRAD -0.104; TCGA STAD -0.332; TCGA UCEC -0.38
hsa-miR-429
SLC25A12
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.11; TCGA BRCA -0.054; TCGA COAD -0.057; TCGA ESCA -0.167; TCGA HNSC -0.058; TCGA LIHC -0.079; TCGA PAAD -0.1; TCGA STAD -0.199; TCGA UCEC -0.056
hsa-miR-429
PPP1R12A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.109; TCGA BRCA -0.09; TCGA CESC -0.097; TCGA COAD -0.108; TCGA ESCA -0.162; TCGA HNSC -0.08; TCGA KIRC -0.065; TCGA LUAD -0.098; TCGA PAAD -0.109; TCGA PRAD -0.072; TCGA STAD -0.231; TCGA UCEC -0.172
hsa-miR-429
CDKN1A
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD
miRNATAP
TCGA BLCA -0.077; TCGA BRCA -0.089; TCGA CESC -0.097; TCGA ESCA -0.135; TCGA HNSC -0.109; TCGA KIRC -0.148; TCGA LUAD -0.1; TCGA LUSC -0.15; TCGA PRAD -0.11
hsa-miR-429
MAP3K3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.164; TCGA BRCA -0.135; TCGA CESC -0.147; TCGA COAD -0.26; TCGA ESCA -0.164; TCGA HNSC -0.213; TCGA LUAD -0.087; TCGA LUSC -0.256; TCGA PAAD -0.215; TCGA STAD -0.21; TCGA UCEC -0.191
hsa-miR-429
KCNE4
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.419; TCGA CESC -0.223; TCGA COAD -0.622; TCGA ESCA -0.31; TCGA HNSC -0.38; TCGA KIRC -0.454; TCGA KIRP -0.218; TCGA LUSC -0.214; TCGA OV -0.163; TCGA PAAD -0.286; TCGA PRAD -0.093; TCGA STAD -0.356; TCGA UCEC -0.407
hsa-miR-429
SLITRK4
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.332; TCGA BRCA -0.259; TCGA CESC -0.276; TCGA ESCA -0.354; TCGA HNSC -0.609; TCGA LUAD -0.291; TCGA LUSC -0.319; TCGA OV -0.291; TCGA PAAD -0.408; TCGA STAD -0.453; TCGA UCEC -0.242
hsa-miR-429
ELOVL4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.268; TCGA BRCA -0.077; TCGA CESC -0.37; TCGA COAD -0.58; TCGA ESCA -0.446; TCGA HNSC -0.165; TCGA KIRP -0.529; TCGA OV -0.203; TCGA PAAD -0.181; TCGA STAD -0.404; TCGA UCEC -0.333
hsa-miR-429
TRAK2
9 cancers: BLCA; BRCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.103; TCGA BRCA -0.108; TCGA HNSC -0.114; TCGA KIRP -0.1; TCGA LUAD -0.057; TCGA LUSC -0.192; TCGA PAAD -0.095; TCGA STAD -0.119; TCGA UCEC -0.062
hsa-miR-429
CXorf36
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.139; TCGA BRCA -0.364; TCGA CESC -0.318; TCGA COAD -0.443; TCGA ESCA -0.133; TCGA HNSC -0.303; TCGA KIRC -0.402; TCGA LIHC -0.099; TCGA LUAD -0.229; TCGA LUSC -0.422; TCGA OV -0.068; TCGA PAAD -0.199; TCGA PRAD -0.093; TCGA STAD -0.202; TCGA UCEC -0.338
hsa-miR-429
HIVEP3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD
miRNATAP
TCGA BLCA -0.225; TCGA CESC -0.284; TCGA COAD -0.224; TCGA ESCA -0.169; TCGA HNSC -0.219; TCGA KIRC -0.111; TCGA LUAD -0.12; TCGA LUSC -0.242; TCGA STAD -0.076
hsa-miR-429
CAV2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.258; TCGA BRCA -0.433; TCGA CESC -0.386; TCGA COAD -0.43; TCGA ESCA -0.322; TCGA HNSC -0.126; TCGA KIRC -0.372; TCGA KIRP -0.277; TCGA LUAD -0.291; TCGA LUSC -0.22; TCGA PRAD -0.089; TCGA STAD -0.23; TCGA UCEC -0.256
hsa-miR-429
TMOD2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.139; TCGA BRCA -0.187; TCGA CESC -0.309; TCGA COAD -0.343; TCGA ESCA -0.151; TCGA HNSC -0.242; TCGA KIRC -0.146; TCGA LUAD -0.178; TCGA LUSC -0.293; TCGA PAAD -0.168; TCGA PRAD -0.052; TCGA STAD -0.289; TCGA UCEC -0.355
hsa-miR-429
MAP3K14
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.149; TCGA BRCA -0.052; TCGA CESC -0.117; TCGA COAD -0.09; TCGA ESCA -0.102; TCGA HNSC -0.097; TCGA KIRC -0.225; TCGA KIRP -0.119; TCGA LIHC -0.063; TCGA LUAD -0.086; TCGA LUSC -0.15; TCGA PAAD -0.131; TCGA STAD -0.127; TCGA UCEC -0.094
hsa-miR-429
IL17RD
9 cancers: BLCA; BRCA; COAD; ESCA; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.201; TCGA BRCA -0.148; TCGA COAD -0.194; TCGA ESCA -0.112; TCGA OV -0.119; TCGA PAAD -0.136; TCGA PRAD -0.055; TCGA STAD -0.324; TCGA UCEC -0.156
hsa-miR-429
NMNAT2
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.257; TCGA BRCA -0.412; TCGA COAD -0.441; TCGA HNSC -0.198; TCGA KIRC -0.316; TCGA LUSC -0.461; TCGA THCA -0.134; TCGA STAD -0.331; TCGA UCEC -0.102
hsa-miR-429
CD4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRNATAP
TCGA BLCA -0.282; TCGA BRCA -0.068; TCGA CESC -0.316; TCGA COAD -0.39; TCGA ESCA -0.205; TCGA HNSC -0.326; TCGA KIRC -0.375; TCGA KIRP -0.229; TCGA LUAD -0.248; TCGA LUSC -0.51; TCGA PAAD -0.381
hsa-miR-429
DPT
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.752; TCGA BRCA -0.615; TCGA CESC -0.483; TCGA COAD -1.158; TCGA ESCA -0.588; TCGA HNSC -0.533; TCGA LUAD -0.272; TCGA LUSC -0.558; TCGA OV -0.408; TCGA PAAD -0.501; TCGA PRAD -0.203; TCGA STAD -0.59; TCGA UCEC -0.685
hsa-miR-429
KIF17
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.254; TCGA BRCA -0.213; TCGA CESC -0.286; TCGA COAD -0.581; TCGA ESCA -0.309; TCGA LUAD -0.273; TCGA LUSC -0.324; TCGA PAAD -0.343; TCGA PRAD -0.065; TCGA STAD -0.165; TCGA UCEC -0.159
hsa-miR-429
HECW2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.148; TCGA CESC -0.209; TCGA COAD -0.256; TCGA HNSC -0.172; TCGA KIRC -0.357; TCGA KIRP -0.46; TCGA LUAD -0.111; TCGA LUSC -0.307; TCGA PAAD -0.168; TCGA PRAD -0.116; TCGA UCEC -0.114
hsa-miR-429
ATP1A2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.56; TCGA BRCA -0.909; TCGA CESC -0.214; TCGA COAD -1.255; TCGA ESCA -0.779; TCGA HNSC -0.873; TCGA LUSC -0.656; TCGA PAAD -0.405; TCGA PRAD -0.152; TCGA STAD -0.929; TCGA UCEC -0.361
hsa-miR-429
FYCO1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.065; TCGA BRCA -0.159; TCGA COAD -0.075; TCGA ESCA -0.095; TCGA HNSC -0.265; TCGA LIHC -0.05; TCGA LUSC -0.224; TCGA PRAD -0.082; TCGA STAD -0.249; TCGA UCEC -0.161
hsa-miR-429
SNX9
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.089; TCGA BRCA -0.079; TCGA CESC -0.065; TCGA HNSC -0.193; TCGA KIRP -0.083; TCGA LUAD -0.057; TCGA LUSC -0.086; TCGA PAAD -0.08; TCGA STAD -0.055; TCGA UCEC -0.066
hsa-miR-429
PLEK
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRNATAP
TCGA BLCA -0.443; TCGA BRCA -0.074; TCGA CESC -0.291; TCGA COAD -0.421; TCGA ESCA -0.21; TCGA HNSC -0.319; TCGA KIRC -0.458; TCGA KIRP -0.31; TCGA LUAD -0.284; TCGA LUSC -0.449; TCGA PAAD -0.535; TCGA PRAD -0.068
hsa-miR-429
NEK7
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.082; TCGA BRCA -0.137; TCGA CESC -0.059; TCGA COAD -0.106; TCGA ESCA -0.108; TCGA HNSC -0.12; TCGA LUAD -0.064; TCGA LUSC -0.201; TCGA PRAD -0.07; TCGA STAD -0.103; TCGA UCEC -0.108
hsa-miR-429
CYGB
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.285; TCGA CESC -0.247; TCGA COAD -0.297; TCGA HNSC -0.153; TCGA KIRC -0.353; TCGA LUAD -0.142; TCGA LUSC -0.217; TCGA PAAD -0.118; TCGA PRAD -0.051; TCGA STAD -0.071; TCGA UCEC -0.118
hsa-miR-429
GUCY1A3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.192; TCGA BRCA -0.201; TCGA CESC -0.215; TCGA COAD -0.754; TCGA ESCA -0.365; TCGA HNSC -0.301; TCGA KIRC -0.136; TCGA KIRP -0.126; TCGA LUSC -0.298; TCGA PAAD -0.38; TCGA STAD -0.409; TCGA UCEC -0.129
hsa-miR-429
NOTCH2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.152; TCGA BRCA -0.091; TCGA COAD -0.163; TCGA ESCA -0.154; TCGA HNSC -0.146; TCGA LUAD -0.079; TCGA LUSC -0.166; TCGA PAAD -0.29; TCGA PRAD -0.057; TCGA STAD -0.179; TCGA UCEC -0.083
hsa-miR-429
EGFLAM
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.16; TCGA BRCA -0.315; TCGA CESC -0.213; TCGA COAD -0.341; TCGA ESCA -0.163; TCGA HNSC -0.198; TCGA KIRC -0.346; TCGA LUAD -0.194; TCGA PAAD -0.245; TCGA PRAD -0.143; TCGA STAD -0.106; TCGA UCEC -0.153
hsa-miR-429
CCDC69
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.207; TCGA BRCA -0.44; TCGA CESC -0.293; TCGA COAD -0.516; TCGA ESCA -0.394; TCGA HNSC -0.304; TCGA LIHC -0.058; TCGA LUAD -0.133; TCGA LUSC -0.48; TCGA PAAD -0.441; TCGA PRAD -0.084; TCGA STAD -0.463; TCGA UCEC -0.254
hsa-miR-429
FGF1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; STAD
miRNATAP
TCGA BLCA -0.267; TCGA BRCA -0.325; TCGA CESC -0.278; TCGA COAD -0.673; TCGA ESCA -0.323; TCGA LUAD -0.116; TCGA LUSC -0.373; TCGA OV -0.273; TCGA PAAD -0.147; TCGA STAD -0.33
hsa-miR-429
VCL
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.158; TCGA BRCA -0.132; TCGA CESC -0.114; TCGA COAD -0.213; TCGA ESCA -0.172; TCGA HNSC -0.17; TCGA LUAD -0.136; TCGA LUSC -0.155; TCGA PAAD -0.088; TCGA PRAD -0.141; TCGA STAD -0.255; TCGA UCEC -0.164
hsa-miR-429
ST8SIA1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.39; TCGA BRCA -0.175; TCGA CESC -0.387; TCGA COAD -0.606; TCGA ESCA -0.458; TCGA HNSC -0.182; TCGA KIRC -0.18; TCGA LUAD -0.147; TCGA LUSC -0.151; TCGA OV -0.178; TCGA PAAD -0.362; TCGA STAD -0.373; TCGA UCEC -0.395
hsa-miR-429
C8orf46
10 cancers: BLCA; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.165; TCGA ESCA -0.394; TCGA KIRC -0.144; TCGA KIRP -0.164; TCGA LIHC -0.197; TCGA LUSC -0.299; TCGA PAAD -0.239; TCGA PRAD -0.08; TCGA STAD -0.697; TCGA UCEC -0.293
hsa-miR-429
PID1
11 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.341; TCGA BRCA -0.457; TCGA CESC -0.439; TCGA HNSC -0.218; TCGA LIHC -0.072; TCGA LUAD -0.133; TCGA LUSC -0.254; TCGA PAAD -0.305; TCGA PRAD -0.175; TCGA STAD -0.298; TCGA UCEC -0.463
hsa-miR-429
TPM1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.353; TCGA CESC -0.185; TCGA COAD -0.142; TCGA ESCA -0.185; TCGA HNSC -0.421; TCGA KIRC -0.151; TCGA LUSC -0.198; TCGA PRAD -0.07; TCGA STAD -0.37; TCGA UCEC -0.268
hsa-miR-429
FAM78A
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.268; TCGA CESC -0.25; TCGA COAD -0.31; TCGA ESCA -0.087; TCGA HNSC -0.311; TCGA KIRC -0.462; TCGA KIRP -0.17; TCGA LUAD -0.186; TCGA LUSC -0.429; TCGA PAAD -0.434; TCGA UCEC -0.106
hsa-miR-429
ELN
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.297; TCGA BRCA -0.259; TCGA COAD -0.634; TCGA ESCA -0.235; TCGA HNSC -0.249; TCGA KIRC -0.134; TCGA LUSC -0.314; TCGA OV -0.21; TCGA PAAD -0.356; TCGA PRAD -0.074; TCGA STAD -0.319; TCGA UCEC -0.184
hsa-miR-429
JPH2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.494; TCGA BRCA -0.353; TCGA CESC -0.586; TCGA COAD -0.841; TCGA ESCA -0.574; TCGA HNSC -0.723; TCGA KIRC -0.336; TCGA KIRP -0.204; TCGA LUAD -0.185; TCGA LUSC -0.548; TCGA PAAD -0.245; TCGA PRAD -0.096; TCGA STAD -0.756; TCGA UCEC -0.562
hsa-miR-429
SAMD4A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.313; TCGA BRCA -0.283; TCGA CESC -0.355; TCGA COAD -0.411; TCGA ESCA -0.233; TCGA HNSC -0.291; TCGA KIRC -0.072; TCGA LUAD -0.16; TCGA LUSC -0.303; TCGA PAAD -0.221; TCGA PRAD -0.07; TCGA STAD -0.338; TCGA UCEC -0.327
hsa-miR-429
PLEKHO2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.242; TCGA BRCA -0.128; TCGA CESC -0.19; TCGA COAD -0.346; TCGA ESCA -0.22; TCGA HNSC -0.198; TCGA KIRC -0.231; TCGA KIRP -0.11; TCGA LUAD -0.218; TCGA LUSC -0.307; TCGA PAAD -0.286; TCGA PRAD -0.064; TCGA STAD -0.177; TCGA UCEC -0.123
hsa-miR-429
FMOD
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.334; TCGA BRCA -0.33; TCGA CESC -0.146; TCGA COAD -0.339; TCGA HNSC -0.297; TCGA KIRP -0.201; TCGA LUAD -0.161; TCGA LUSC -0.377; TCGA OV -0.109; TCGA PAAD -0.156; TCGA STAD -0.133; TCGA UCEC -0.179
hsa-miR-429
TSC22D3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.211; TCGA BRCA -0.172; TCGA CESC -0.116; TCGA COAD -0.445; TCGA ESCA -0.223; TCGA KIRC -0.16; TCGA LIHC -0.084; TCGA LUSC -0.3; TCGA PAAD -0.295; TCGA PRAD -0.08; TCGA STAD -0.297; TCGA UCEC -0.187
hsa-miR-429
TBXAS1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRNATAP
TCGA BLCA -0.385; TCGA BRCA -0.068; TCGA CESC -0.248; TCGA HNSC -0.256; TCGA KIRC -0.348; TCGA KIRP -0.369; TCGA LUAD -0.104; TCGA LUSC -0.474; TCGA PAAD -0.114
hsa-miR-429
DAAM2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.264; TCGA BRCA -0.338; TCGA CESC -0.231; TCGA COAD -0.546; TCGA ESCA -0.369; TCGA HNSC -0.443; TCGA KIRC -0.114; TCGA LIHC -0.065; TCGA LUSC -0.472; TCGA OV -0.116; TCGA PAAD -0.419; TCGA PRAD -0.125; TCGA STAD -0.453; TCGA UCEC -0.206
hsa-miR-429
UNC5C
10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.389; TCGA BRCA -0.271; TCGA COAD -0.453; TCGA HNSC -0.498; TCGA LUAD -0.241; TCGA LUSC -0.655; TCGA PAAD -0.366; TCGA PRAD -0.163; TCGA STAD -0.067; TCGA UCEC -0.109
hsa-miR-429
PRKCDBP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.336; TCGA BRCA -0.087; TCGA CESC -0.272; TCGA COAD -0.468; TCGA ESCA -0.164; TCGA HNSC -0.217; TCGA KIRC -0.407; TCGA LUAD -0.143; TCGA LUSC -0.275; TCGA OV -0.148; TCGA PRAD -0.067; TCGA STAD -0.152; TCGA UCEC -0.221
hsa-miR-429
FBN1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.46; TCGA BRCA -0.313; TCGA CESC -0.442; TCGA COAD -0.699; TCGA ESCA -0.376; TCGA HNSC -0.543; TCGA KIRC -0.278; TCGA KIRP -0.349; TCGA LUAD -0.27; TCGA LUSC -0.484; TCGA OV -0.174; TCGA PAAD -0.388; TCGA PRAD -0.134; TCGA STAD -0.265; TCGA UCEC -0.365
hsa-miR-429
TMEM132B
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.213; TCGA BRCA -0.234; TCGA COAD -0.25; TCGA ESCA -0.203; TCGA KIRC -0.153; TCGA KIRP -0.249; TCGA OV -0.221; TCGA PAAD -0.155; TCGA PRAD -0.156; TCGA THCA -0.065; TCGA STAD -0.272; TCGA UCEC -0.12
hsa-miR-429
SCARA3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.313; TCGA BRCA -0.143; TCGA CESC -0.213; TCGA COAD -0.545; TCGA ESCA -0.332; TCGA LUAD -0.094; TCGA OV -0.142; TCGA PAAD -0.334; TCGA STAD -0.415; TCGA UCEC -0.187
hsa-miR-429
NGFR
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.512; TCGA BRCA -0.365; TCGA COAD -0.906; TCGA ESCA -0.589; TCGA KIRC -0.258; TCGA OV -0.216; TCGA PAAD -0.516; TCGA STAD -0.598; TCGA UCEC -0.386
hsa-miR-429
CAMK2A
10 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.619; TCGA CESC -0.6; TCGA ESCA -0.273; TCGA HNSC -0.826; TCGA LUAD -0.197; TCGA LUSC -0.422; TCGA PAAD -0.345; TCGA PRAD -0.21; TCGA STAD -0.502; TCGA UCEC -0.555
hsa-miR-429
CDYL2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD
miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.068; TCGA CESC -0.247; TCGA COAD -0.284; TCGA ESCA -0.115; TCGA HNSC -0.326; TCGA LUAD -0.235; TCGA LUSC -0.33; TCGA PAAD -0.225; TCGA PRAD -0.087
hsa-miR-429
C1orf21
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; OV; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.067; TCGA BRCA -0.073; TCGA CESC -0.237; TCGA HNSC -0.082; TCGA KIRP -0.259; TCGA LIHC -0.118; TCGA OV -0.113; TCGA THCA -0.06; TCGA STAD -0.195; TCGA UCEC -0.21
hsa-miR-429
EYA4
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.246; TCGA BRCA -0.441; TCGA COAD -0.661; TCGA ESCA -0.403; TCGA HNSC -0.292; TCGA LIHC -0.161; TCGA LUAD -0.25; TCGA PAAD -0.423; TCGA STAD -0.283; TCGA UCEC -0.452
hsa-miR-429
CYTH4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD
miRNATAP
TCGA BLCA -0.408; TCGA BRCA -0.081; TCGA CESC -0.335; TCGA COAD -0.406; TCGA ESCA -0.222; TCGA HNSC -0.288; TCGA KIRC -0.447; TCGA KIRP -0.213; TCGA LUAD -0.199; TCGA LUSC -0.429; TCGA PAAD -0.381
hsa-miR-429
DIO3
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.295; TCGA BRCA -0.347; TCGA CESC -0.496; TCGA ESCA -0.265; TCGA HNSC -0.576; TCGA LUSC -0.351; TCGA PAAD -0.196; TCGA STAD -0.289; TCGA UCEC -0.443
hsa-miR-429
COL6A3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.383; TCGA BRCA -0.156; TCGA CESC -0.331; TCGA COAD -0.635; TCGA ESCA -0.29; TCGA HNSC -0.491; TCGA KIRC -0.514; TCGA LUAD -0.214; TCGA LUSC -0.318; TCGA PAAD -0.374; TCGA PRAD -0.145; TCGA STAD -0.194; TCGA UCEC -0.318
hsa-miR-429
KATNAL1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.4; TCGA BRCA -0.158; TCGA CESC -0.228; TCGA COAD -0.329; TCGA ESCA -0.299; TCGA HNSC -0.262; TCGA KIRC -0.147; TCGA KIRP -0.143; TCGA LIHC -0.063; TCGA LUAD -0.137; TCGA LUSC -0.245; TCGA OV -0.078; TCGA PAAD -0.116; TCGA PRAD -0.066; TCGA STAD -0.328; TCGA UCEC -0.272
hsa-miR-429
FOXN3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.107; TCGA BRCA -0.304; TCGA COAD -0.128; TCGA ESCA -0.148; TCGA HNSC -0.126; TCGA KIRC -0.086; TCGA LIHC -0.055; TCGA LUAD -0.052; TCGA PAAD -0.203; TCGA PRAD -0.069; TCGA STAD -0.201; TCGA UCEC -0.209
hsa-miR-429
POU2F2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.296; TCGA CESC -0.28; TCGA COAD -0.404; TCGA ESCA -0.167; TCGA HNSC -0.199; TCGA KIRC -0.4; TCGA KIRP -0.18; TCGA LUSC -0.354; TCGA PAAD -0.476; TCGA PRAD -0.08; TCGA STAD -0.159
hsa-miR-429
FGF13
9 cancers: BLCA; BRCA; COAD; ESCA; OV; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.206; TCGA BRCA -0.095; TCGA COAD -0.355; TCGA ESCA -0.296; TCGA OV -0.183; TCGA PAAD -0.167; TCGA THCA -0.079; TCGA STAD -0.331; TCGA UCEC -0.306
hsa-miR-429
C3orf18
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.133; TCGA BRCA -0.082; TCGA CESC -0.173; TCGA COAD -0.286; TCGA ESCA -0.208; TCGA HNSC -0.281; TCGA LIHC -0.157; TCGA LUSC -0.289; TCGA PAAD -0.13; TCGA STAD -0.26; TCGA UCEC -0.21
hsa-miR-429
MACF1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.162; TCGA BRCA -0.071; TCGA CESC -0.081; TCGA COAD -0.128; TCGA ESCA -0.185; TCGA HNSC -0.144; TCGA LUSC -0.203; TCGA PAAD -0.114; TCGA STAD -0.225; TCGA UCEC -0.159
hsa-miR-429
DNAJC18
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.148; TCGA BRCA -0.174; TCGA CESC -0.154; TCGA COAD -0.187; TCGA ESCA -0.242; TCGA HNSC -0.183; TCGA KIRP -0.101; TCGA LUAD -0.078; TCGA LUSC -0.184; TCGA PAAD -0.121; TCGA STAD -0.326; TCGA UCEC -0.223
hsa-miR-429
COTL1
9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; THCA
miRNATAP
TCGA BLCA -0.156; TCGA CESC -0.22; TCGA COAD -0.149; TCGA HNSC -0.165; TCGA KIRP -0.106; TCGA LUAD -0.136; TCGA LUSC -0.308; TCGA PAAD -0.15; TCGA THCA -0.068
hsa-miR-429
SPIRE1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.179; TCGA CESC -0.187; TCGA COAD -0.286; TCGA ESCA -0.242; TCGA HNSC -0.078; TCGA KIRC -0.131; TCGA KIRP -0.177; TCGA LUAD -0.054; TCGA LUSC -0.105; TCGA STAD -0.257; TCGA UCEC -0.169
hsa-miR-429
ZFYVE1
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; STAD
miRNATAP
TCGA BLCA -0.052; TCGA BRCA -0.056; TCGA CESC -0.064; TCGA COAD -0.093; TCGA ESCA -0.112; TCGA HNSC -0.109; TCGA LIHC -0.053; TCGA LUSC -0.057; TCGA STAD -0.094
hsa-miR-429
HDX
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.087; TCGA BRCA -0.06; TCGA CESC -0.376; TCGA COAD -0.347; TCGA ESCA -0.324; TCGA HNSC -0.272; TCGA LIHC -0.067; TCGA LUAD -0.154; TCGA LUSC -0.3; TCGA PAAD -0.222; TCGA STAD -0.333; TCGA UCEC -0.303
hsa-miR-429
TOX2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.372; TCGA BRCA -0.161; TCGA CESC -0.394; TCGA COAD -0.235; TCGA ESCA -0.396; TCGA HNSC -0.187; TCGA KIRC -0.301; TCGA KIRP -0.168; TCGA LIHC -0.082; TCGA LUAD -0.158; TCGA LUSC -0.371; TCGA OV -0.189; TCGA PAAD -0.141; TCGA STAD -0.16; TCGA UCEC -0.115
hsa-miR-429
COL4A4
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.235; TCGA BRCA -0.123; TCGA CESC -0.323; TCGA COAD -0.324; TCGA HNSC -0.192; TCGA LUSC -0.496; TCGA PAAD -0.434; TCGA PRAD -0.094; TCGA STAD -0.251; TCGA UCEC -0.254
hsa-miR-429
B4GALNT1
13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.384; TCGA CESC -0.351; TCGA COAD -0.408; TCGA ESCA -0.427; TCGA KIRC -0.448; TCGA KIRP -0.623; TCGA LIHC -0.153; TCGA LUAD -0.17; TCGA PAAD -0.233; TCGA PRAD -0.094; TCGA THCA -0.063; TCGA STAD -0.234; TCGA UCEC -0.14
hsa-miR-429
LRRC15
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.451; TCGA CESC -0.268; TCGA COAD -0.619; TCGA ESCA -0.262; TCGA HNSC -0.634; TCGA KIRC -0.254; TCGA LUAD -0.261; TCGA LUSC -0.334; TCGA PAAD -0.467; TCGA UCEC -0.178
hsa-miR-429
SORBS1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.399; TCGA BRCA -0.489; TCGA CESC -0.187; TCGA COAD -0.482; TCGA ESCA -0.323; TCGA HNSC -0.424; TCGA KIRC -0.119; TCGA LUSC -0.464; TCGA PAAD -0.138; TCGA PRAD -0.13; TCGA STAD -0.597; TCGA UCEC -0.399
hsa-miR-429
PTGIS
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.57; TCGA BRCA -0.373; TCGA CESC -0.534; TCGA COAD -1.058; TCGA ESCA -0.651; TCGA HNSC -0.656; TCGA KIRP -0.341; TCGA LUAD -0.253; TCGA LUSC -0.564; TCGA OV -0.218; TCGA PAAD -0.409; TCGA PRAD -0.139; TCGA STAD -0.625; TCGA UCEC -0.728
hsa-miR-429
TTC28
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.054; TCGA BRCA -0.294; TCGA CESC -0.1; TCGA COAD -0.401; TCGA ESCA -0.239; TCGA HNSC -0.092; TCGA KIRC -0.129; TCGA LUAD -0.111; TCGA LUSC -0.18; TCGA PAAD -0.244; TCGA PRAD -0.063; TCGA STAD -0.305; TCGA UCEC -0.13
hsa-miR-429
CCND2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; OV; STAD; UCEC
miRNATAP
TCGA BLCA -0.317; TCGA BRCA -0.232; TCGA CESC -0.458; TCGA ESCA -0.194; TCGA HNSC -0.122; TCGA KIRC -0.227; TCGA LUAD -0.209; TCGA OV -0.203; TCGA STAD -0.201; TCGA UCEC -0.347
hsa-miR-429
CORO2B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.235; TCGA BRCA -0.478; TCGA CESC -0.462; TCGA COAD -0.571; TCGA ESCA -0.348; TCGA HNSC -0.48; TCGA LUAD -0.13; TCGA LUSC -0.549; TCGA PAAD -0.245; TCGA STAD -0.379; TCGA UCEC -0.361
hsa-miR-429
PLXDC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.148; TCGA CESC -0.319; TCGA COAD -0.319; TCGA ESCA -0.152; TCGA HNSC -0.281; TCGA KIRC -0.583; TCGA LUSC -0.226; TCGA PAAD -0.205; TCGA PRAD -0.053; TCGA STAD -0.119; TCGA UCEC -0.25
hsa-miR-429
SAMD8
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUAD; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.184; TCGA COAD -0.129; TCGA HNSC -0.071; TCGA KIRP -0.103; TCGA LUAD -0.152; TCGA PAAD -0.093; TCGA PRAD -0.064; TCGA STAD -0.11
hsa-miR-429
CHST15
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.41; TCGA CESC -0.202; TCGA COAD -0.467; TCGA ESCA -0.232; TCGA HNSC -0.178; TCGA KIRC -0.3; TCGA LUSC -0.113; TCGA PAAD -0.208; TCGA PRAD -0.1; TCGA STAD -0.288; TCGA UCEC -0.122
hsa-miR-429
GREM2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.179; TCGA BRCA -0.46; TCGA CESC -0.293; TCGA COAD -0.907; TCGA ESCA -0.445; TCGA HNSC -0.3; TCGA LIHC -0.355; TCGA LUSC -0.482; TCGA PAAD -0.379; TCGA THCA -0.09; TCGA STAD -0.554; TCGA UCEC -0.343
hsa-miR-429
RAB11FIP2
9 cancers: BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.158; TCGA CESC -0.119; TCGA COAD -0.099; TCGA HNSC -0.148; TCGA LUAD -0.088; TCGA LUSC -0.22; TCGA PAAD -0.123; TCGA STAD -0.148; TCGA UCEC -0.208
hsa-miR-429
FLT1
11 cancers: BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BRCA -0.212; TCGA CESC -0.201; TCGA COAD -0.24; TCGA HNSC -0.198; TCGA KIRC -0.338; TCGA LUAD -0.19; TCGA LUSC -0.264; TCGA PAAD -0.108; TCGA PRAD -0.13; TCGA STAD -0.053; TCGA UCEC -0.121
hsa-miR-429
SYNJ1
9 cancers: BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.081; TCGA COAD -0.084; TCGA HNSC -0.103; TCGA LUAD -0.063; TCGA LUSC -0.133; TCGA PAAD -0.086; TCGA PRAD -0.06; TCGA STAD -0.065; TCGA UCEC -0.107
hsa-miR-429
TMEM43
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BRCA -0.115; TCGA CESC -0.154; TCGA COAD -0.084; TCGA ESCA -0.131; TCGA HNSC -0.077; TCGA KIRC -0.124; TCGA LUAD -0.105; TCGA LUSC -0.104; TCGA PAAD -0.096; TCGA STAD -0.179; TCGA UCEC -0.171
hsa-miR-429
FIGN
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; PITA; miRanda
TCGA BRCA -0.274; TCGA CESC -0.395; TCGA COAD -0.706; TCGA ESCA -0.426; TCGA HNSC -0.417; TCGA KIRC -0.094; TCGA LUAD -0.202; TCGA LUSC -0.346; TCGA PAAD -0.214; TCGA PRAD -0.122; TCGA STAD -0.357
hsa-miR-429
SWAP70
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BRCA -0.107; TCGA COAD -0.152; TCGA ESCA -0.116; TCGA HNSC -0.07; TCGA KIRC -0.099; TCGA LUAD -0.078; TCGA LUSC -0.158; TCGA PAAD -0.227; TCGA STAD -0.102; TCGA UCEC -0.055
hsa-miR-429
TSC22D2
9 cancers: BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BRCA -0.061; TCGA CESC -0.104; TCGA ESCA -0.118; TCGA HNSC -0.189; TCGA LUAD -0.178; TCGA LUSC -0.061; TCGA PRAD -0.052; TCGA STAD -0.095; TCGA UCEC -0.09
hsa-miR-429
SPAG9
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BRCA -0.128; TCGA CESC -0.082; TCGA COAD -0.079; TCGA ESCA -0.068; TCGA HNSC -0.115; TCGA KIRC -0.054; TCGA KIRP -0.124; TCGA LUAD -0.086; TCGA LUSC -0.095; TCGA PAAD -0.109; TCGA STAD -0.099; TCGA UCEC -0.127
hsa-miR-429
PLEKHM3
9 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BRCA -0.247; TCGA COAD -0.101; TCGA ESCA -0.071; TCGA HNSC -0.096; TCGA KIRP -0.099; TCGA LUSC -0.066; TCGA PAAD -0.111; TCGA STAD -0.175; TCGA UCEC -0.17
hsa-miR-429
FAT3
12 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.412; TCGA COAD -0.608; TCGA ESCA -0.593; TCGA HNSC -0.332; TCGA KIRP -0.33; TCGA LUAD -0.186; TCGA LUSC -0.294; TCGA OV -0.215; TCGA PAAD -0.366; TCGA PRAD -0.187; TCGA STAD -0.739; TCGA UCEC -0.384
hsa-miR-429
ZNF423
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.361; TCGA COAD -0.356; TCGA ESCA -0.32; TCGA HNSC -0.425; TCGA KIRC -0.132; TCGA LUAD -0.187; TCGA LUSC -0.469; TCGA PAAD -0.297; TCGA PRAD -0.1; TCGA STAD -0.369; TCGA UCEC -0.158
hsa-miR-429
KIAA0355
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.141; TCGA CESC -0.094; TCGA COAD -0.077; TCGA ESCA -0.097; TCGA HNSC -0.12; TCGA KIRC -0.063; TCGA LUAD -0.09; TCGA LUSC -0.174; TCGA PAAD -0.109; TCGA STAD -0.116; TCGA UCEC -0.106
hsa-miR-429
PKIA
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.305; TCGA CESC -0.296; TCGA COAD -0.565; TCGA ESCA -0.244; TCGA HNSC -0.405; TCGA LUAD -0.102; TCGA OV -0.457; TCGA PAAD -0.127; TCGA PRAD -0.097; TCGA STAD -0.383; TCGA UCEC -0.359
hsa-miR-429
SASH1
9 cancers: BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BRCA -0.228; TCGA COAD -0.167; TCGA HNSC -0.198; TCGA LIHC -0.05; TCGA LUAD -0.119; TCGA LUSC -0.152; TCGA PAAD -0.229; TCGA STAD -0.188; TCGA UCEC -0.091
hsa-miR-429
ATP11C
13 cancers: BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.131; TCGA CESC -0.128; TCGA COAD -0.134; TCGA ESCA -0.088; TCGA KIRC -0.065; TCGA KIRP -0.131; TCGA LIHC -0.142; TCGA LUAD -0.091; TCGA PAAD -0.256; TCGA PRAD -0.07; TCGA THCA -0.052; TCGA STAD -0.066; TCGA UCEC -0.141
hsa-miR-429
KCND2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BRCA -0.218; TCGA CESC -0.315; TCGA COAD -0.979; TCGA ESCA -0.372; TCGA HNSC -0.395; TCGA LUSC -0.155; TCGA PAAD -0.217; TCGA STAD -0.236; TCGA UCEC -0.268
hsa-miR-429
BTBD11
9 cancers: BRCA; CESC; COAD; ESCA; KIRP; LUAD; OV; PAAD; PRAD
PITA; miRanda
TCGA BRCA -0.248; TCGA CESC -0.212; TCGA COAD -0.246; TCGA ESCA -0.217; TCGA KIRP -0.282; TCGA LUAD -0.161; TCGA OV -0.273; TCGA PAAD -0.198; TCGA PRAD -0.1
hsa-miR-429
ZFAND5
10 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; mirMAP
TCGA BRCA -0.105; TCGA ESCA -0.102; TCGA HNSC -0.072; TCGA KIRP -0.107; TCGA LIHC -0.105; TCGA LUAD -0.053; TCGA LUSC -0.104; TCGA PAAD -0.062; TCGA STAD -0.136; TCGA UCEC -0.063
hsa-miR-429
PRKAR1A
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BRCA -0.087; TCGA CESC -0.077; TCGA COAD -0.113; TCGA ESCA -0.07; TCGA HNSC -0.08; TCGA LUAD -0.06; TCGA LUSC -0.109; TCGA PAAD -0.081; TCGA STAD -0.098; TCGA UCEC -0.118
hsa-miR-429
SLC23A2
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BRCA -0.127; TCGA CESC -0.147; TCGA COAD -0.129; TCGA ESCA -0.116; TCGA HNSC -0.067; TCGA LIHC -0.067; TCGA LUSC -0.107; TCGA STAD -0.117; TCGA UCEC -0.231
hsa-miR-429
MAP3K8
9 cancers: BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; THCA; STAD
PITA; miRanda
TCGA BRCA -0.164; TCGA COAD -0.13; TCGA ESCA -0.102; TCGA KIRC -0.107; TCGA LUAD -0.074; TCGA LUSC -0.245; TCGA PAAD -0.284; TCGA THCA -0.058; TCGA STAD -0.058
hsa-miR-429
CITED2
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BRCA -0.124; TCGA CESC -0.164; TCGA COAD -0.146; TCGA ESCA -0.213; TCGA HNSC -0.176; TCGA LUAD -0.093; TCGA LUSC -0.266; TCGA PAAD -0.118; TCGA PRAD -0.058; TCGA THCA -0.062; TCGA STAD -0.22; TCGA UCEC -0.252
hsa-miR-429
VGLL3
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BRCA -0.347; TCGA CESC -0.445; TCGA COAD -0.8; TCGA ESCA -0.42; TCGA HNSC -0.542; TCGA LUAD -0.345; TCGA LUSC -0.643; TCGA PAAD -0.354; TCGA PRAD -0.367; TCGA STAD -0.368; TCGA UCEC -0.485
hsa-miR-429
RAB8B
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BRCA -0.151; TCGA CESC -0.206; TCGA COAD -0.218; TCGA ESCA -0.104; TCGA HNSC -0.203; TCGA KIRC -0.119; TCGA LUAD -0.226; TCGA LUSC -0.313; TCGA PAAD -0.191; TCGA STAD -0.097; TCGA UCEC -0.247
hsa-miR-429
SLC38A2
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BRCA -0.083; TCGA CESC -0.135; TCGA COAD -0.065; TCGA ESCA -0.196; TCGA HNSC -0.135; TCGA KIRC -0.11; TCGA LUAD -0.093; TCGA PAAD -0.114; TCGA PRAD -0.051; TCGA STAD -0.064; TCGA UCEC -0.088
hsa-miR-429
NLGN4X
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD
PITA; miRanda; miRNATAP
TCGA BRCA -0.35; TCGA COAD -0.643; TCGA ESCA -0.421; TCGA HNSC -0.439; TCGA KIRC -0.109; TCGA LIHC -0.102; TCGA LUAD -0.2; TCGA LUSC -0.195; TCGA PAAD -0.48; TCGA STAD -0.348
hsa-miR-429
CHD9
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BRCA -0.173; TCGA CESC -0.075; TCGA COAD -0.073; TCGA ESCA -0.084; TCGA HNSC -0.076; TCGA LUSC -0.107; TCGA PAAD -0.077; TCGA STAD -0.101; TCGA UCEC -0.145
hsa-miR-429
TRIM9
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BRCA -0.136; TCGA CESC -0.201; TCGA COAD -0.613; TCGA ESCA -0.459; TCGA HNSC -0.196; TCGA KIRC -0.467; TCGA OV -0.141; TCGA PAAD -0.216; TCGA PRAD -0.125; TCGA STAD -0.363; TCGA UCEC -0.362
hsa-miR-429
CAST
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BRCA -0.101; TCGA CESC -0.095; TCGA ESCA -0.082; TCGA HNSC -0.091; TCGA KIRC -0.071; TCGA LUAD -0.084; TCGA LUSC -0.148; TCGA STAD -0.103; TCGA UCEC -0.073
hsa-miR-429
TRIM6
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BRCA -0.176; TCGA CESC -0.434; TCGA COAD -0.469; TCGA ESCA -0.245; TCGA HNSC -0.285; TCGA LUAD -0.189; TCGA LUSC -0.283; TCGA PAAD -0.218; TCGA UCEC -0.147
hsa-miR-429
ST3GAL5
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.136; TCGA CESC -0.277; TCGA COAD -0.256; TCGA ESCA -0.144; TCGA HNSC -0.172; TCGA KIRC -0.179; TCGA KIRP -0.206; TCGA LUSC -0.316; TCGA OV -0.085; TCGA PAAD -0.152; TCGA PRAD -0.05; TCGA STAD -0.133; TCGA UCEC -0.221
hsa-miR-429
KLF8
9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.181; TCGA CESC -0.238; TCGA COAD -0.375; TCGA ESCA -0.299; TCGA KIRC -0.138; TCGA LUAD -0.085; TCGA PAAD -0.268; TCGA STAD -0.377; TCGA UCEC -0.154
hsa-miR-429
PRKCH
10 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.116; TCGA CESC -0.138; TCGA COAD -0.252; TCGA ESCA -0.151; TCGA KIRC -0.196; TCGA LUAD -0.109; TCGA LUSC -0.064; TCGA PAAD -0.273; TCGA STAD -0.128; TCGA UCEC -0.058
hsa-miR-429
TGFBR3
9 cancers: BRCA; COAD; ESCA; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.443; TCGA COAD -0.197; TCGA ESCA -0.146; TCGA LIHC -0.127; TCGA LUAD -0.185; TCGA PAAD -0.321; TCGA PRAD -0.082; TCGA STAD -0.38; TCGA UCEC -0.404
hsa-miR-429
IDS
10 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.082; TCGA COAD -0.203; TCGA ESCA -0.092; TCGA HNSC -0.098; TCGA KIRC -0.105; TCGA KIRP -0.073; TCGA LUAD -0.083; TCGA LUSC -0.129; TCGA STAD -0.166; TCGA UCEC -0.103
hsa-miR-429
RTN4
9 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BRCA -0.097; TCGA CESC -0.14; TCGA ESCA -0.098; TCGA HNSC -0.156; TCGA KIRP -0.105; TCGA LUAD -0.103; TCGA LUSC -0.089; TCGA STAD -0.129; TCGA UCEC -0.096
hsa-miR-429
DMXL1
9 cancers: BRCA; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.145; TCGA ESCA -0.061; TCGA HNSC -0.062; TCGA KIRP -0.082; TCGA LUSC -0.125; TCGA PAAD -0.09; TCGA PRAD -0.131; TCGA STAD -0.092; TCGA UCEC -0.074
hsa-miR-429
FAM171B
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.169; TCGA CESC -0.169; TCGA COAD -0.469; TCGA ESCA -0.11; TCGA HNSC -0.211; TCGA KIRC -0.117; TCGA KIRP -0.51; TCGA LUAD -0.113; TCGA PAAD -0.215; TCGA STAD -0.198; TCGA UCEC -0.162
hsa-miR-429
MMP19
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.163; TCGA CESC -0.132; TCGA COAD -0.255; TCGA ESCA -0.127; TCGA HNSC -0.117; TCGA KIRC -0.202; TCGA LUAD -0.14; TCGA LUSC -0.253; TCGA OV -0.075; TCGA PAAD -0.213; TCGA STAD -0.053; TCGA UCEC -0.096
hsa-miR-429
MOSPD2
10 cancers: BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; UCEC
miRanda
TCGA BRCA -0.089; TCGA COAD -0.083; TCGA HNSC -0.063; TCGA KIRC -0.069; TCGA KIRP -0.179; TCGA LIHC -0.052; TCGA LUAD -0.111; TCGA LUSC -0.119; TCGA PAAD -0.102; TCGA UCEC -0.058
hsa-miR-429
FAM160B1
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.121; TCGA CESC -0.112; TCGA COAD -0.084; TCGA ESCA -0.053; TCGA HNSC -0.106; TCGA KIRC -0.1; TCGA KIRP -0.059; TCGA LUAD -0.077; TCGA LUSC -0.119; TCGA PAAD -0.097; TCGA STAD -0.105; TCGA UCEC -0.094
hsa-miR-429
MYOF
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BRCA -0.078; TCGA CESC -0.144; TCGA COAD -0.244; TCGA ESCA -0.13; TCGA HNSC -0.127; TCGA KIRC -0.223; TCGA LUAD -0.158; TCGA LUSC -0.171; TCGA STAD -0.143; TCGA UCEC -0.069
hsa-miR-429
PRTG
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.314; TCGA CESC -0.419; TCGA COAD -0.674; TCGA HNSC -0.367; TCGA KIRP -0.32; TCGA LUSC -0.609; TCGA OV -0.179; TCGA PAAD -0.345; TCGA PRAD -0.125; TCGA STAD -0.336; TCGA UCEC -0.385
hsa-miR-429
LMO2
9 cancers: BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.212; TCGA CESC -0.208; TCGA COAD -0.351; TCGA HNSC -0.124; TCGA LUAD -0.19; TCGA LUSC -0.186; TCGA PAAD -0.187; TCGA STAD -0.125; TCGA UCEC -0.082
hsa-miR-429
CRIM1
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.25; TCGA CESC -0.203; TCGA COAD -0.083; TCGA ESCA -0.137; TCGA HNSC -0.24; TCGA LUAD -0.154; TCGA LUSC -0.217; TCGA PAAD -0.082; TCGA STAD -0.185; TCGA UCEC -0.205
hsa-miR-429
FBLN1
9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BRCA -0.264; TCGA COAD -0.773; TCGA ESCA -0.5; TCGA HNSC -0.19; TCGA LUAD -0.194; TCGA LUSC -0.106; TCGA PAAD -0.41; TCGA PRAD -0.115; TCGA STAD -0.422
hsa-miR-429
ABCG2
12 cancers: BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.349; TCGA CESC -0.289; TCGA COAD -0.244; TCGA HNSC -0.192; TCGA KIRC -0.095; TCGA LIHC -0.22; TCGA LUAD -0.351; TCGA LUSC -0.46; TCGA PAAD -0.147; TCGA PRAD -0.106; TCGA STAD -0.112; TCGA UCEC -0.475
hsa-miR-429
EPAS1
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.359; TCGA CESC -0.155; TCGA COAD -0.142; TCGA ESCA -0.101; TCGA HNSC -0.158; TCGA KIRC -0.133; TCGA LUAD -0.204; TCGA LUSC -0.35; TCGA PAAD -0.126; TCGA PRAD -0.078; TCGA STAD -0.097; TCGA UCEC -0.106
hsa-miR-429
EIF4B
10 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.084; TCGA CESC -0.072; TCGA HNSC -0.066; TCGA KIRC -0.102; TCGA KIRP -0.128; TCGA LUAD -0.068; TCGA LUSC -0.055; TCGA OV -0.057; TCGA PAAD -0.058; TCGA UCEC -0.105
hsa-miR-429
IQSEC1
9 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BRCA -0.134; TCGA COAD -0.105; TCGA ESCA -0.095; TCGA HNSC -0.176; TCGA LIHC -0.054; TCGA LUAD -0.088; TCGA LUSC -0.296; TCGA STAD -0.125; TCGA UCEC -0.111
hsa-miR-429
RBPMS
9 cancers: BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.141; TCGA COAD -0.252; TCGA ESCA -0.163; TCGA HNSC -0.095; TCGA LUSC -0.206; TCGA PAAD -0.074; TCGA PRAD -0.076; TCGA STAD -0.325; TCGA UCEC -0.139
hsa-miR-429
MOCS1
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; STAD
miRanda; miRNATAP
TCGA BRCA -0.305; TCGA CESC -0.143; TCGA COAD -0.143; TCGA ESCA -0.144; TCGA HNSC -0.276; TCGA LIHC -0.124; TCGA LUSC -0.275; TCGA PAAD -0.173; TCGA STAD -0.232
hsa-miR-429
KAT2B
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.252; TCGA CESC -0.087; TCGA COAD -0.121; TCGA ESCA -0.102; TCGA HNSC -0.273; TCGA LIHC -0.127; TCGA LUAD -0.122; TCGA LUSC -0.296; TCGA PAAD -0.112; TCGA PRAD -0.056; TCGA STAD -0.186; TCGA UCEC -0.107
hsa-miR-429
FAM13C
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.448; TCGA CESC -0.321; TCGA COAD -0.637; TCGA ESCA -0.289; TCGA HNSC -0.51; TCGA KIRC -0.136; TCGA LIHC -0.124; TCGA LUAD -0.214; TCGA LUSC -0.438; TCGA PAAD -0.387; TCGA PRAD -0.114; TCGA STAD -0.338; TCGA UCEC -0.312
hsa-miR-429
BBS9
9 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.065; TCGA COAD -0.075; TCGA ESCA -0.071; TCGA HNSC -0.057; TCGA LIHC -0.055; TCGA LUSC -0.076; TCGA PAAD -0.07; TCGA STAD -0.121; TCGA UCEC -0.056
hsa-miR-429
RAPGEF4
9 cancers: BRCA; CESC; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; UCEC
miRanda; miRNATAP
TCGA BRCA -0.161; TCGA CESC -0.193; TCGA COAD -0.233; TCGA HNSC -0.162; TCGA KIRC -0.113; TCGA LIHC -0.073; TCGA LUAD -0.095; TCGA LUSC -0.241; TCGA UCEC -0.258
hsa-miR-429
SOCS5
9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.105; TCGA COAD -0.072; TCGA ESCA -0.056; TCGA HNSC -0.105; TCGA LUAD -0.078; TCGA LUSC -0.088; TCGA PAAD -0.14; TCGA STAD -0.139; TCGA UCEC -0.129
hsa-miR-429
C1QTNF3
9 cancers: BRCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.126; TCGA COAD -0.485; TCGA ESCA -0.281; TCGA HNSC -0.161; TCGA LIHC -0.191; TCGA OV -0.17; TCGA PAAD -0.214; TCGA STAD -0.356; TCGA UCEC -0.059
hsa-miR-429
GNS
9 cancers: BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD
miRanda
TCGA BRCA -0.147; TCGA CESC -0.076; TCGA COAD -0.096; TCGA HNSC -0.114; TCGA KIRP -0.174; TCGA LIHC -0.057; TCGA LUAD -0.061; TCGA LUSC -0.158; TCGA PAAD -0.052
hsa-miR-429
ANO6
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.265; TCGA CESC -0.169; TCGA COAD -0.138; TCGA ESCA -0.135; TCGA HNSC -0.233; TCGA KIRC -0.118; TCGA KIRP -0.144; TCGA LUAD -0.213; TCGA LUSC -0.241; TCGA PAAD -0.144; TCGA PRAD -0.093; TCGA STAD -0.157; TCGA UCEC -0.23
hsa-miR-429
ANGPT2
10 cancers: BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV
miRanda
TCGA BRCA -0.156; TCGA CESC -0.158; TCGA COAD -0.161; TCGA HNSC -0.188; TCGA KIRC -0.721; TCGA KIRP -0.257; TCGA LIHC -0.101; TCGA LUAD -0.223; TCGA LUSC -0.117; TCGA OV -0.105
hsa-miR-429
TMEM64
11 cancers: BRCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BRCA -0.174; TCGA CESC -0.129; TCGA COAD -0.176; TCGA HNSC -0.054; TCGA KIRP -0.083; TCGA LIHC -0.108; TCGA LUAD -0.164; TCGA LUSC -0.164; TCGA PAAD -0.126; TCGA PRAD -0.079; TCGA UCEC -0.239
hsa-miR-429
KCNMB4
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.136; TCGA CESC -0.285; TCGA COAD -0.254; TCGA ESCA -0.238; TCGA HNSC -0.111; TCGA LUAD -0.16; TCGA PAAD -0.134; TCGA STAD -0.274; TCGA UCEC -0.152
hsa-miR-429
SH3BP5
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda
TCGA BRCA -0.149; TCGA COAD -0.248; TCGA ESCA -0.182; TCGA HNSC -0.125; TCGA KIRC -0.077; TCGA KIRP -0.259; TCGA LUAD -0.143; TCGA LUSC -0.311; TCGA PAAD -0.347; TCGA THCA -0.066; TCGA STAD -0.2; TCGA UCEC -0.269
hsa-miR-429
EHD3
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.082; TCGA CESC -0.203; TCGA COAD -0.39; TCGA ESCA -0.24; TCGA HNSC -0.172; TCGA LUAD -0.133; TCGA LUSC -0.068; TCGA PAAD -0.225; TCGA STAD -0.222; TCGA UCEC -0.099
hsa-miR-429
APLF
9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.088; TCGA CESC -0.195; TCGA ESCA -0.148; TCGA HNSC -0.161; TCGA KIRC -0.076; TCGA LUAD -0.066; TCGA PAAD -0.123; TCGA STAD -0.187; TCGA UCEC -0.057
hsa-miR-429
TMEM47
11 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BRCA -0.312; TCGA COAD -0.504; TCGA ESCA -0.343; TCGA HNSC -0.345; TCGA LUAD -0.123; TCGA LUSC -0.348; TCGA OV -0.171; TCGA PAAD -0.148; TCGA PRAD -0.145; TCGA STAD -0.381; TCGA UCEC -0.277
hsa-miR-429
ANKRD40
10 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BRCA -0.141; TCGA CESC -0.056; TCGA ESCA -0.062; TCGA HNSC -0.088; TCGA KIRP -0.065; TCGA LUAD -0.068; TCGA LUSC -0.062; TCGA PAAD -0.066; TCGA STAD -0.136; TCGA UCEC -0.128
hsa-miR-429
MAST4
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.23; TCGA CESC -0.247; TCGA COAD -0.159; TCGA ESCA -0.212; TCGA HNSC -0.139; TCGA KIRP -0.255; TCGA PRAD -0.106; TCGA STAD -0.188; TCGA UCEC -0.106
hsa-miR-429
MDFIC
12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRanda; miRNATAP
TCGA BRCA -0.254; TCGA CESC -0.235; TCGA COAD -0.471; TCGA ESCA -0.279; TCGA HNSC -0.162; TCGA KIRC -0.076; TCGA LUAD -0.179; TCGA LUSC -0.216; TCGA OV -0.135; TCGA PAAD -0.356; TCGA STAD -0.253; TCGA UCEC -0.294
hsa-miR-429
PDE10A
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; STAD; UCEC
mirMAP
TCGA BRCA -0.178; TCGA CESC -0.244; TCGA COAD -0.428; TCGA ESCA -0.119; TCGA HNSC -0.153; TCGA LUAD -0.13; TCGA LUSC -0.133; TCGA OV -0.149; TCGA STAD -0.171; TCGA UCEC -0.275
hsa-miR-429
BNIP2
9 cancers: BRCA; CESC; COAD; ESCA; KIRC; LUAD; PAAD; STAD; UCEC
mirMAP
TCGA BRCA -0.112; TCGA CESC -0.093; TCGA COAD -0.1; TCGA ESCA -0.087; TCGA KIRC -0.086; TCGA LUAD -0.104; TCGA PAAD -0.153; TCGA STAD -0.144; TCGA UCEC -0.074
hsa-miR-429
FRMD3
9 cancers: BRCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.303; TCGA CESC -0.192; TCGA COAD -0.189; TCGA HNSC -0.461; TCGA LUAD -0.295; TCGA LUSC -0.604; TCGA PRAD -0.129; TCGA STAD -0.126; TCGA UCEC -0.191
hsa-miR-429
BMPR2
9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BRCA -0.123; TCGA COAD -0.162; TCGA ESCA -0.079; TCGA HNSC -0.188; TCGA LUAD -0.104; TCGA LUSC -0.205; TCGA PAAD -0.084; TCGA STAD -0.124; TCGA UCEC -0.127
hsa-miR-429
FRZB
10 cancers: BRCA; CESC; COAD; HNSC; KIRC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.17; TCGA CESC -0.248; TCGA COAD -0.337; TCGA HNSC -0.292; TCGA KIRC -0.214; TCGA LUSC -0.413; TCGA PAAD -0.149; TCGA PRAD -0.124; TCGA STAD -0.418; TCGA UCEC -0.174
hsa-miR-429
AR
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.353; TCGA CESC -0.224; TCGA COAD -0.693; TCGA ESCA -0.317; TCGA HNSC -0.471; TCGA LIHC -0.301; TCGA LUSC -0.445; TCGA PAAD -0.4; TCGA PRAD -0.094; TCGA STAD -0.546; TCGA UCEC -0.131
hsa-miR-429
DLG2
12 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.314; TCGA COAD -0.797; TCGA ESCA -0.414; TCGA HNSC -0.159; TCGA LUAD -0.152; TCGA LUSC -0.31; TCGA OV -0.195; TCGA PAAD -0.455; TCGA PRAD -0.11; TCGA THCA -0.102; TCGA STAD -0.57; TCGA UCEC -0.236
hsa-miR-429
C20orf194
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.186; TCGA CESC -0.103; TCGA COAD -0.693; TCGA ESCA -0.316; TCGA HNSC -0.085; TCGA LUSC -0.096; TCGA PAAD -0.13; TCGA STAD -0.342; TCGA UCEC -0.17
hsa-miR-429
NOTCH4
10 cancers: BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.261; TCGA CESC -0.153; TCGA COAD -0.265; TCGA HNSC -0.149; TCGA KIRC -0.295; TCGA LUAD -0.125; TCGA LUSC -0.296; TCGA PAAD -0.103; TCGA STAD -0.079; TCGA UCEC -0.135
hsa-miR-429
ZBTB4
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.13; TCGA CESC -0.099; TCGA COAD -0.149; TCGA ESCA -0.204; TCGA HNSC -0.087; TCGA LUSC -0.132; TCGA PAAD -0.078; TCGA PRAD -0.051; TCGA STAD -0.243; TCGA UCEC -0.152
hsa-miR-429
PTPRB
9 cancers: BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.385; TCGA CESC -0.269; TCGA HNSC -0.342; TCGA LUAD -0.187; TCGA LUSC -0.485; TCGA PAAD -0.179; TCGA PRAD -0.087; TCGA STAD -0.105; TCGA UCEC -0.205
hsa-miR-429
KIT
10 cancers: BRCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.337; TCGA COAD -0.374; TCGA ESCA -0.168; TCGA HNSC -0.228; TCGA LUSC -0.188; TCGA OV -0.293; TCGA PAAD -0.205; TCGA PRAD -0.083; TCGA STAD -0.314; TCGA UCEC -0.257
hsa-miR-429
ACSL1
10 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.359; TCGA ESCA -0.092; TCGA HNSC -0.132; TCGA KIRP -0.192; TCGA LIHC -0.173; TCGA LUSC -0.123; TCGA PAAD -0.166; TCGA THCA -0.063; TCGA STAD -0.076; TCGA UCEC -0.085
hsa-miR-429
PTPRM
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.339; TCGA CESC -0.387; TCGA COAD -0.474; TCGA ESCA -0.205; TCGA HNSC -0.282; TCGA KIRC -0.145; TCGA KIRP -0.089; TCGA LUAD -0.164; TCGA LUSC -0.465; TCGA PAAD -0.1; TCGA PRAD -0.144; TCGA STAD -0.26; TCGA UCEC -0.163
hsa-miR-429
RBMS1
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.187; TCGA CESC -0.185; TCGA COAD -0.491; TCGA ESCA -0.247; TCGA HNSC -0.078; TCGA LUAD -0.119; TCGA LUSC -0.051; TCGA PAAD -0.221; TCGA STAD -0.234; TCGA UCEC -0.2
hsa-miR-429
PRRT4
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.54; TCGA CESC -0.221; TCGA COAD -0.345; TCGA ESCA -0.508; TCGA HNSC -0.255; TCGA LIHC -0.122; TCGA PAAD -0.262; TCGA STAD -0.456; TCGA UCEC -0.308
hsa-miR-429
PIM1
13 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.104; TCGA CESC -0.138; TCGA COAD -0.101; TCGA ESCA -0.182; TCGA HNSC -0.157; TCGA KIRC -0.098; TCGA KIRP -0.151; TCGA LUAD -0.05; TCGA LUSC -0.262; TCGA PAAD -0.108; TCGA THCA -0.059; TCGA STAD -0.099; TCGA UCEC -0.161
hsa-miR-429
PDE7B
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.326; TCGA CESC -0.344; TCGA COAD -0.459; TCGA ESCA -0.252; TCGA HNSC -0.341; TCGA LUSC -0.127; TCGA PAAD -0.293; TCGA PRAD -0.067; TCGA STAD -0.42; TCGA UCEC -0.353
hsa-miR-429
OSR1
9 cancers: BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.369; TCGA COAD -0.857; TCGA ESCA -0.331; TCGA KIRC -0.146; TCGA LUAD -0.095; TCGA LUSC -0.119; TCGA PAAD -0.417; TCGA STAD -0.288; TCGA UCEC -0.408
hsa-miR-429
JPH4
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.241; TCGA CESC -0.359; TCGA COAD -0.667; TCGA ESCA -0.265; TCGA HNSC -0.179; TCGA LUAD -0.214; TCGA LUSC -0.403; TCGA PAAD -0.242; TCGA PRAD -0.089; TCGA STAD -0.308; TCGA UCEC -0.654
hsa-miR-429
CRYBG3
10 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.365; TCGA COAD -0.215; TCGA ESCA -0.092; TCGA HNSC -0.082; TCGA LIHC -0.078; TCGA LUAD -0.068; TCGA PAAD -0.135; TCGA PRAD -0.055; TCGA STAD -0.151; TCGA UCEC -0.243
hsa-miR-429
TLE4
9 cancers: BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.202; TCGA CESC -0.131; TCGA COAD -0.119; TCGA ESCA -0.162; TCGA HNSC -0.092; TCGA PAAD -0.156; TCGA PRAD -0.071; TCGA STAD -0.185; TCGA UCEC -0.294
hsa-miR-429
CREB3L2
10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.063; TCGA CESC -0.102; TCGA COAD -0.107; TCGA ESCA -0.118; TCGA HNSC -0.18; TCGA LUSC -0.151; TCGA PAAD -0.108; TCGA PRAD -0.058; TCGA STAD -0.123; TCGA UCEC -0.138
hsa-miR-429
SOCS2
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.311; TCGA CESC -0.363; TCGA COAD -0.154; TCGA ESCA -0.133; TCGA HNSC -0.094; TCGA LUAD -0.173; TCGA LUSC -0.143; TCGA PAAD -0.132; TCGA PRAD -0.092; TCGA STAD -0.169; TCGA UCEC -0.365
hsa-miR-429
KIAA1324L
9 cancers: BRCA; COAD; ESCA; LUAD; LUSC; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.143; TCGA COAD -0.413; TCGA ESCA -0.331; TCGA LUAD -0.135; TCGA LUSC -0.155; TCGA OV -0.283; TCGA PAAD -0.321; TCGA STAD -0.317; TCGA UCEC -0.201
hsa-miR-429
GM2A
11 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; STAD
miRNATAP
TCGA BRCA -0.053; TCGA CESC -0.213; TCGA COAD -0.118; TCGA ESCA -0.219; TCGA HNSC -0.059; TCGA KIRC -0.259; TCGA KIRP -0.199; TCGA LIHC -0.053; TCGA LUAD -0.146; TCGA PAAD -0.178; TCGA STAD -0.089
hsa-miR-429
SLC6A1
10 cancers: CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA CESC -0.3; TCGA COAD -0.302; TCGA HNSC -0.329; TCGA KIRC -0.484; TCGA KIRP -0.165; TCGA LIHC -0.144; TCGA LUSC -0.326; TCGA PAAD -0.125; TCGA STAD -0.201; TCGA UCEC -0.242
hsa-miR-429
PAG1
9 cancers: CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
MirTarget; PITA; miRNATAP
TCGA CESC -0.116; TCGA HNSC -0.28; TCGA KIRC -0.359; TCGA KIRP -0.124; TCGA LUAD -0.127; TCGA LUSC -0.41; TCGA PAAD -0.186; TCGA PRAD -0.053; TCGA UCEC -0.084
hsa-miR-429
AMFR
9 cancers: CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA CESC -0.081; TCGA ESCA -0.072; TCGA HNSC -0.078; TCGA KIRP -0.099; TCGA LIHC -0.063; TCGA LUAD -0.075; TCGA LUSC -0.068; TCGA STAD -0.061; TCGA UCEC -0.072
hsa-miR-429
NELL2
10 cancers: CESC; COAD; ESCA; KIRC; KIRP; OV; PAAD; PRAD; STAD; UCEC
miRanda
TCGA CESC -0.225; TCGA COAD -0.401; TCGA ESCA -0.485; TCGA KIRC -0.335; TCGA KIRP -0.245; TCGA OV -0.318; TCGA PAAD -0.391; TCGA PRAD -0.198; TCGA STAD -0.22; TCGA UCEC -0.114
hsa-miR-429
SHISA4
10 cancers: CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
miRNATAP
TCGA CESC -0.172; TCGA COAD -0.473; TCGA ESCA -0.153; TCGA HNSC -0.373; TCGA KIRP -0.126; TCGA LIHC -0.149; TCGA LUSC -0.219; TCGA PAAD -0.076; TCGA STAD -0.234; TCGA UCEC -0.078
hsa-miR-429
JAKMIP2
10 cancers: CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA CESC -0.37; TCGA COAD -0.731; TCGA ESCA -0.369; TCGA KIRC -0.221; TCGA LIHC -0.204; TCGA LUAD -0.148; TCGA LUSC -0.367; TCGA PRAD -0.097; TCGA STAD -0.405; TCGA UCEC -0.293
hsa-miR-429
ZNF365
9 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; STAD
PITA; miRanda
TCGA COAD -0.739; TCGA ESCA -0.496; TCGA HNSC -0.258; TCGA KIRC -0.227; TCGA KIRP -0.344; TCGA LUAD -0.19; TCGA LUSC -0.266; TCGA OV -0.134; TCGA STAD -0.408
hsa-miR-429
FAM198A
9 cancers: COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA COAD -0.849; TCGA ESCA -0.395; TCGA HNSC -0.275; TCGA LUAD -0.094; TCGA LUSC -0.38; TCGA PAAD -0.401; TCGA PRAD -0.064; TCGA STAD -0.426; TCGA UCEC -0.196
hsa-miR-429
GNA13
9 cancers: COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA COAD -0.061; TCGA HNSC -0.085; TCGA KIRC -0.126; TCGA KIRP -0.165; TCGA LUAD -0.125; TCGA LUSC -0.075; TCGA PAAD -0.168; TCGA STAD -0.067; TCGA UCEC -0.092
hsa-miR-429
MAPT
10 cancers: COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; STAD; UCEC
miRNATAP
TCGA COAD -0.677; TCGA ESCA -0.426; TCGA HNSC -0.324; TCGA KIRC -0.182; TCGA KIRP -0.471; TCGA LIHC -0.1; TCGA LUSC -0.154; TCGA THCA -0.068; TCGA STAD -0.586; TCGA UCEC -0.249





Enriched cancer pathways of putative targets