microRNA information: hsa-miR-432-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-432-5p | miRbase |
| Accession: | MIMAT0002814 | miRbase |
| Precursor name: | hsa-mir-432 | miRbase |
| Precursor accession: | MI0003133 | miRbase |
| Symbol: | MIR432 | HGNC |
| RefSeq ID: | NR_030173 | GenBank |
| Sequence: | UCUUGGAGUAGGUCAUUGGGUGG |
Reported expression in cancers: hsa-miR-432-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-432-5p | liver cancer | deregulation | "Downregulation of miR 432 activates Wnt/β catenin ......" | 25797263 | |
| hsa-miR-432-5p | lung cancer | downregulation | "Here we report that downregulation of miR-432 in L ......" | 26942465 |
Reported cancer pathway affected by hsa-miR-432-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-432-5p | lung cancer | cell cycle pathway | "MicroRNA 432 functions as a tumor suppressor gene ......" | 26942465 |
Reported cancer prognosis affected by hsa-miR-432-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-432-5p | lung cancer | staging; worse prognosis | "MicroRNA 432 functions as a tumor suppressor gene ......" | 26942465 | |
| hsa-miR-432-5p | melanoma | progression | "In situ analysis of melanoma samples using progres ......" | 23728176 |
Reported gene related to hsa-miR-432-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-432-5p | melanoma | ADAR | "We found that cancer cells silence ADAR1 by overex ......" | 23728176 |
| hsa-miR-432-5p | lung cancer | AXL | "MicroRNA 432 functions as a tumor suppressor gene ......" | 26942465 |
| hsa-miR-432-5p | lung cancer | E2F3 | "MicroRNA 432 functions as a tumor suppressor gene ......" | 26942465 |
| hsa-miR-432-5p | cervical and endocervical cancer | HSF1 | "We also show that HSF1 regulates hsa-miR-432 expre ......" | 25280995 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-432-5p | ZNF296 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; PAAD; UCEC | MirTarget | TCGA BLCA -0.116; TCGA BRCA -0.181; TCGA CESC -0.164; TCGA ESCA -0.182; TCGA HNSC -0.134; TCGA LGG -0.084; TCGA LUAD -0.063; TCGA PAAD -0.202; TCGA UCEC -0.079 |
hsa-miR-432-5p | ESRRA | 9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; OV; PAAD; UCEC | miRNATAP | TCGA BLCA -0.086; TCGA BRCA -0.059; TCGA CESC -0.075; TCGA ESCA -0.167; TCGA KIRC -0.059; TCGA LGG -0.091; TCGA OV -0.083; TCGA PAAD -0.183; TCGA UCEC -0.064 |
hsa-miR-432-5p | KIAA1522 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.076; TCGA BRCA -0.149; TCGA CESC -0.073; TCGA ESCA -0.119; TCGA HNSC -0.103; TCGA LUAD -0.054; TCGA PAAD -0.214; TCGA PRAD -0.131; TCGA SARC -0.146; TCGA STAD -0.118; TCGA UCEC -0.072 |
Enriched cancer pathways of putative targets