microRNA information: hsa-miR-448
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-448 | miRbase |
| Accession: | MIMAT0001532 | miRbase |
| Precursor name: | hsa-mir-448 | miRbase |
| Precursor accession: | MI0001637 | miRbase |
| Symbol: | MIR448 | HGNC |
| RefSeq ID: | NR_029955 | GenBank |
| Sequence: | UUGCAUAUGUAGGAUGUCCCAU |
Reported expression in cancers: hsa-miR-448
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-448 | breast cancer | downregulation | "In this study we reported that miR-448 is the most ......" | 20798686 | |
| hsa-miR-448 | breast cancer | downregulation | "Using siRNA technique we demonstrated that pterost ......" | 23504987 | |
| hsa-miR-448 | colorectal cancer | downregulation | "Accumulating evidence has demonstrated that miR-44 ......" | 27508021 | qPCR |
| hsa-miR-448 | gastric cancer | downregulation | "Previous studies showed that miR-448 expression wa ......" | 26852749 | |
| hsa-miR-448 | liver cancer | upregulation | "miR-448 has been reported to exhibit abnormal expr ......" | 25969175 | qPCR |
Reported cancer pathway affected by hsa-miR-448
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-448 | liver cancer | Epithelial mesenchymal transition pathway | "Low Expression of miR 448 Induces EMT and Promotes ......" | 25969175 | Transwell assay; Luciferase; Western blot |
Reported cancer prognosis affected by hsa-miR-448
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-448 | breast cancer | metastasis; poor survival; progression | "Aberrant KDM5B expression promotes aggressive brea ......" | 26917489 | |
| hsa-miR-448 | colorectal cancer | staging; metastasis | "miR 448 suppresses proliferation and invasion by r ......" | 27508021 | Colony formation; Western blot; Luciferase |
| hsa-miR-448 | gastric cancer | progression | "MiR 448 promotes glycolytic metabolism of gastric ......" | 26989077 | |
| hsa-miR-448 | liver cancer | progression | "Low Expression of miR 448 Induces EMT and Promotes ......" | 25969175 | Transwell assay; Luciferase; Western blot |
| hsa-miR-448 | lung squamous cell cancer | progression | "We found that miR-34b and miR-520h might play impo ......" | 25702651 | |
| hsa-miR-448 | ovarian cancer | metastasis; progression | "miR 448 negatively regulates ovarian cancer cell g ......" | 26103953 | Luciferase; Colony formation |
Reported gene related to hsa-miR-448
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-448 | gastric cancer | ADAM10 | "miR 448 suppressed gastric cancer proliferation an ......" | 26852749 |
| hsa-miR-448 | ovarian cancer | CXCL12 | "miR 448 negatively regulates ovarian cancer cell g ......" | 26103953 |
| hsa-miR-448 | colorectal cancer | IGF1R | "miR 448 suppresses proliferation and invasion by r ......" | 27508021 |
| hsa-miR-448 | gastric cancer | KDM2B | "MiR 448 promotes glycolytic metabolism of gastric ......" | 26989077 |
| hsa-miR-448 | breast cancer | KDM5B | "Aberrant KDM5B expression promotes aggressive brea ......" | 26917489 |
| hsa-miR-448 | breast cancer | MALAT1 | "Aberrant KDM5B expression promotes aggressive brea ......" | 26917489 |
| hsa-miR-448 | liver cancer | ROCK2 | "Low Expression of miR 448 Induces EMT and Promotes ......" | 25969175 |