microRNA information: hsa-miR-449a
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-449a | miRbase |
Accession: | MIMAT0001541 | miRbase |
Precursor name: | hsa-mir-449a | miRbase |
Precursor accession: | MI0001648 | miRbase |
Symbol: | MIR449A | HGNC |
RefSeq ID: | NR_029960 | GenBank |
Sequence: | UGGCAGUGUAUUGUUAGCUGGU |
Reported expression in cancers: hsa-miR-449a
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-449a | bladder cancer | downregulation | "MicroRNA 449a acts as a tumor suppressor in human ......" | 22266187 | |
hsa-miR-449a | gastric cancer | downregulation | "miR 449 inhibits cell proliferation and is down re ......" | 21418558 | qPCR |
hsa-miR-449a | gastric cancer | downregulation | "MicroRNA-449a is a tumor suppressor that is down-r ......" | 25871967 | |
hsa-miR-449a | liver cancer | upregulation | "miR-449a expression was lower in liver cancer tiss ......" | 26375440 | |
hsa-miR-449a | lung cancer | downregulation | "MicroRNA-449a miR-449a was significantly downregul ......" | 24211326 | |
hsa-miR-449a | lung cancer | downregulation | "MicroRNA 449a inhibits cell growth in lung cancer ......" | 25818739 | |
hsa-miR-449a | lung squamous cell cancer | downregulation | "MicroRNA-449a is expressed at a low level in sever ......" | 23734217 | qPCR |
hsa-miR-449a | melanoma | deregulation | "An exploratory miRNA analysis of 666 miRs by low d ......" | 20302635 | Microarray |
hsa-miR-449a | prostate cancer | downregulation | "Using real-time PCR we found that miR-449a is down ......" | 19252524 | qPCR |
hsa-miR-449a | prostate cancer | downregulation | "MicroRNAs miRNAs are a class of small non-coding R ......" | 20948989 | RNA-Seq |
hsa-miR-449a | prostate cancer | upregulation | "In the present study cell viability was assessed b ......" | 26081756 | |
hsa-miR-449a | prostate cancer | upregulation | "miR-449a a novel tumor suppressor is deregulated i ......" | 26520443 | |
hsa-miR-449a | sarcoma | downregulation | "Accumulating evidence reveals that miR-449a is exp ......" | 26002578 | |
hsa-miR-449a | thyroid cancer | upregulation | "The present study is aimed to investigate the role ......" | 27633255 |
Reported cancer pathway affected by hsa-miR-449a
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-449a | colorectal cancer | Apoptosis pathway | "miR 449a inhibits colorectal cancer progression by ......" | 27486765 | |
hsa-miR-449a | endometrial cancer | Apoptosis pathway | "MiR 449a functions as a tumor suppressor in endome ......" | 24993091 | Western blot |
hsa-miR-449a | gastric cancer | cell cycle pathway; Apoptosis pathway | "miR 449 inhibits cell proliferation and is down re ......" | 21418558 | Luciferase |
hsa-miR-449a | gastric cancer | Apoptosis pathway | "miR 449a and CDK6 in gastric carcinoma; The presen ......" | 25202363 | Western blot |
hsa-miR-449a | gastric cancer | Apoptosis pathway | "MicroRNA 449a inhibits proliferation and induces a ......" | 25871967 | Western blot; Luciferase; Colony formation |
hsa-miR-449a | gastric cancer | Epithelial mesenchymal transition pathway | "miR 449a targets Flot2 and inhibits gastric cancer ......" | 26576674 | Western blot; Luciferase |
hsa-miR-449a | glioblastoma | Apoptosis pathway | "MiR 449a exerts tumor suppressive functions in hum ......" | 25487955 | Western blot; Luciferase |
hsa-miR-449a | liver cancer | Apoptosis pathway | "Histone deacetylases activate hepatocyte growth fa ......" | 22641068 | Luciferase |
hsa-miR-449a | liver cancer | Apoptosis pathway | "miR 449a promotes liver cancer cell apoptosis by d ......" | 26375440 | Luciferase; Western blot |
hsa-miR-449a | liver cancer | Epithelial mesenchymal transition pathway | "MiR 449a suppresses the epithelial mesenchymal tra ......" | 26471185 | |
hsa-miR-449a | lung cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 449a enhances radiosensitivity in CL1 0 l ......" | 23614048 | |
hsa-miR-449a | lung cancer | cell cycle pathway | "Tumor suppressive microRNA 449a induces growth arr ......" | 24211326 | |
hsa-miR-449a | lung cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 449a inhibits cell growth in lung cancer ......" | 25818739 | |
hsa-miR-449a | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 449a is downregulated in non small cell l ......" | 23734217 | |
hsa-miR-449a | lung squamous cell cancer | Apoptosis pathway | "microRNA 449a suppresses non small cell lung cance ......" | 25424357 | Western blot |
hsa-miR-449a | ovarian cancer | cell cycle pathway | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 | Western blot |
hsa-miR-449a | ovarian cancer | Apoptosis pathway | "MicroRNA 449a reduces cell survival and enhances c ......" | 25179844 | Luciferase |
hsa-miR-449a | ovarian cancer | cell cycle pathway | "The effect of miR-449 and miR-34 on the growth cel ......" | 26770455 | Flow cytometry; Cell Proliferation Assay |
hsa-miR-449a | prostate cancer | cell cycle pathway; Apoptosis pathway | "miR 449a targets HDAC 1 and induces growth arrest ......" | 19252524 | Luciferase |
hsa-miR-449a | prostate cancer | cell cycle pathway | "miR 449a causes Rb dependent cell cycle arrest and ......" | 20948989 | Luciferase |
hsa-miR-449a | prostate cancer | cell cycle pathway | "Capsaicin causes inactivation and degradation of t ......" | 26081756 | MTT assay; Flow cytometry; Western blot |
hsa-miR-449a | prostate cancer | cell cycle pathway; Apoptosis pathway | "miR 449a enhances radiosensitivity through modulat ......" | 26520443 | |
hsa-miR-449a | prostate cancer | cell cycle pathway | "MicroRNA 449a enhances radiosensitivity by downreg ......" | 27250340 | |
hsa-miR-449a | retinoblastoma | Apoptosis pathway | "We are the first to confirm an inhibitory effect o ......" | 24120948 | |
hsa-miR-449a | sarcoma | Apoptosis pathway | "Accumulating evidence reveals that miR-449a is exp ......" | 26002578 | |
hsa-miR-449a | thyroid cancer | cell cycle pathway | "miR 449 overexpression inhibits papillary thyroid ......" | 27633255 |
Reported cancer prognosis affected by hsa-miR-449a
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-449a | breast cancer | progression; malignant trasformation; poor survival | "MiR 449a promotes breast cancer progression by tar ......" | 26934316 | Western blot; Luciferase |
hsa-miR-449a | colorectal cancer | staging; worse prognosis | "Increased miR 449a expression in colorectal carcin ......" | 24396489 | |
hsa-miR-449a | colorectal cancer | progression | "miR 449a inhibits colorectal cancer progression by ......" | 27486765 | |
hsa-miR-449a | endometrial cancer | poor survival | "MiR 449a functions as a tumor suppressor in endome ......" | 24993091 | Western blot |
hsa-miR-449a | gastric cancer | metastasis | "MicroRNA 449a inhibits proliferation and induces a ......" | 25871967 | Western blot; Luciferase; Colony formation |
hsa-miR-449a | glioblastoma | poor survival | "MiR 449a exerts tumor suppressive functions in hum ......" | 25487955 | Western blot; Luciferase |
hsa-miR-449a | liver cancer | metastasis; motility | "MiR 449a suppresses the epithelial mesenchymal tra ......" | 26471185 | |
hsa-miR-449a | lung cancer | poor survival; recurrence; tumorigenesis | "Tumor suppressive microRNA 449a induces growth arr ......" | 24211326 | |
hsa-miR-449a | lung cancer | drug resistance | "To address this issue we inserted microRNA respons ......" | 25132116 | |
hsa-miR-449a | lung squamous cell cancer | worse prognosis; metastasis; poor survival; cell migration; progression | "MicroRNA 449a is downregulated in non small cell l ......" | 23734217 | |
hsa-miR-449a | lung squamous cell cancer | differentiation | "microRNA 449a suppresses non small cell lung cance ......" | 25424357 | Western blot |
hsa-miR-449a | lung squamous cell cancer | metastasis | "MiR 449a suppresses cell invasion by inhibiting MA ......" | 26609480 | |
hsa-miR-449a | ovarian cancer | poor survival; drug resistance | "MicroRNA 449a reduces cell survival and enhances c ......" | 25179844 | Luciferase |
hsa-miR-449a | prostate cancer | progression | "miR 449a causes Rb dependent cell cycle arrest and ......" | 20948989 | Luciferase |
hsa-miR-449a | prostate cancer | drug resistance; progression | "miR 449a enhances radiosensitivity through modulat ......" | 26520443 | |
hsa-miR-449a | prostate cancer | drug resistance | "MicroRNA 449a enhances radiosensitivity by downreg ......" | 27250340 | |
hsa-miR-449a | sarcoma | staging; metastasis; poor survival; progression | "Accumulating evidence reveals that miR-449a is exp ......" | 26002578 | |
hsa-miR-449a | thyroid cancer | progression | "miR 449 overexpression inhibits papillary thyroid ......" | 27633255 |
Reported gene related to hsa-miR-449a
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-449a | endometrial cancer | CDC25A | "MiR 449a functions as a tumor suppressor in endome ......" | 24993091 |
hsa-miR-449a | prostate cancer | CDC25A | "Furthermore we showed that miR-449a enhanced radia ......" | 27250340 |
hsa-miR-449a | prostate cancer | CDC25A | "Furthermore elevated miR-449a downregulates cell c ......" | 26520443 |
hsa-miR-449a | colon cancer | E2F3 | "The 3'UTRs of CCND1 and E2F3 contain miR-449 bindi ......" | 23674142 |
hsa-miR-449a | gastric cancer | E2F3 | "MicroRNA 449a inhibits proliferation and induces a ......" | 25871967 |
hsa-miR-449a | lung cancer | E2F3 | "Tumor suppressive microRNA 449a induces growth arr ......" | 24211326 |
hsa-miR-449a | liver cancer | HDAC9 | "In cell lines inhibition of HDAC significantly inc ......" | 22641068 |
hsa-miR-449a | lung cancer | HDAC9 | "Furthermore co-treatment with miR-449a and HDAC in ......" | 22078727 |
hsa-miR-449a | prostate cancer | HDAC9 | "miR 449a targets HDAC 1 and induces growth arrest ......" | 19252524 |
hsa-miR-449a | gastric cancer | TP53 | "We also show that miR-449 over-expression activate ......" | 21418558 |
hsa-miR-449a | lung squamous cell cancer | TP53 | "Further we transfected microRNA-449a mimic and inh ......" | 25424357 |
hsa-miR-449a | ovarian cancer | TP53 | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 |
hsa-miR-449a | lung squamous cell cancer | BCL2 | "Further we transfected microRNA-449a mimic and inh ......" | 25424357 |
hsa-miR-449a | sarcoma | BCL2 | "Moreover BCL2 an antiapoptotic molecule was identi ......" | 26002578 |
hsa-miR-449a | colon cancer | CCND1 | "The 3'UTRs of CCND1 and E2F3 contain miR-449 bindi ......" | 23674142 |
hsa-miR-449a | prostate cancer | CCND1 | "Luciferase 3'UTR reporter constructs and inhibitor ......" | 20948989 |
hsa-miR-449a | prostate cancer | HDAC1 | "Using a luciferase 3'-UTR reporter system we estab ......" | 19252524 |
hsa-miR-449a | prostate cancer | HDAC1 | "Furthermore elevated miR-449a downregulates cell c ......" | 26520443 |
hsa-miR-449a | liver cancer | MET | "Incubation of HCC cells with trichostatin A or tra ......" | 22641068 |
hsa-miR-449a | lung squamous cell cancer | MET | "MicroRNA 449a is downregulated in non small cell l ......" | 23734217 |
hsa-miR-449a | glioblastoma | MYC | "MiR 449a exerts tumor suppressive functions in hum ......" | 25487955 |
hsa-miR-449a | prostate cancer | MYC | "MicroRNA 449a enhances radiosensitivity by downreg ......" | 27250340 |
hsa-miR-449a | prostate cancer | AR | "Capsaicin causes inactivation and degradation of t ......" | 26081756 |
hsa-miR-449a | liver cancer | CAPN6 | "miR 449a promotes liver cancer cell apoptosis by d ......" | 26375440 |
hsa-miR-449a | gastric cancer | CASP3 | "We also show that miR-449 over-expression activate ......" | 21418558 |
hsa-miR-449a | gastric cancer | CDK6 | "miR 449a and CDK6 in gastric carcinoma; The presen ......" | 25202363 |
hsa-miR-449a | colorectal cancer | CEACAM5 | "Increased miR 449a expression in colorectal carcin ......" | 24396489 |
hsa-miR-449a | breast cancer | CRIP2 | "MiR 449a promotes breast cancer progression by tar ......" | 26934316 |
hsa-miR-449a | breast cancer | CSRP2 | "By utilizing a tri-modal in silico approach for ta ......" | 26934316 |
hsa-miR-449a | prostate cancer | ERG | "Loss of miR 449a in ERG associated prostate cancer ......" | 26988912 |
hsa-miR-449a | gastric cancer | FLOT2 | "miR 449a targets Flot2 and inhibits gastric cancer ......" | 26576674 |
hsa-miR-449a | liver cancer | FOS | "Further studies revealed that the reintroduction o ......" | 26471185 |
hsa-miR-449a | gastric cancer | GAST | "Invitrogen NCode miRNA microarrays identified miR- ......" | 21418558 |
hsa-miR-449a | liver cancer | HGF | "Histone deacetylases activate hepatocyte growth fa ......" | 22641068 |
hsa-miR-449a | prostate cancer | INSR | "MiR-449a was upregulated and c-Myc was downregulat ......" | 27250340 |
hsa-miR-449a | lung squamous cell cancer | MAP2K1 | "MiR 449a suppresses cell invasion by inhibiting MA ......" | 26609480 |
hsa-miR-449a | glioblastoma | MAZ | "Myc-associated zinc-finger protein MAZ was identif ......" | 25487955 |
hsa-miR-449a | bladder cancer | MKI67 | "The growth of T24 tumor xenografts was suppressed ......" | 22266187 |
hsa-miR-449a | lung cancer | NEAT1 | "In this study we aimed to investigate the function ......" | 25818739 |
hsa-miR-449a | ovarian cancer | NOTCH1 | "MicroRNA 449a reduces cell survival and enhances c ......" | 25179844 |
hsa-miR-449a | prostate cancer | PCNA | "Luciferase 3'UTR reporter constructs and inhibitor ......" | 20948989 |
hsa-miR-449a | liver cancer | POU2F1 | "miR 449a promotes liver cancer cell apoptosis by d ......" | 26375440 |
hsa-miR-449a | thyroid cancer | RET | "miR 449 overexpression inhibits papillary thyroid ......" | 27633255 |
hsa-miR-449a | colorectal cancer | SATB2 | "miR 449a inhibits colorectal cancer progression by ......" | 27486765 |
hsa-miR-449a | prostate cancer | SIRT1 | "Loss of miR 449a in ERG associated prostate cancer ......" | 26988912 |
hsa-miR-449a | liver cancer | SNAI1 | "Further studies revealed that the reintroduction o ......" | 26471185 |
hsa-miR-449a | colorectal cancer | STAB2 | "Expression of miR-449a was increased epigeneticall ......" | 27486765 |
hsa-miR-449a | lung squamous cell cancer | SUZ12 | "Furthermore the histone methylation mediated the d ......" | 26609480 |
hsa-miR-449a | gastric cancer | TCF3 | "We also identified E2F3 E2F transcription factor 3 ......" | 25871967 |
hsa-miR-449a | breast cancer | VEGFA | "Our data revealed that overexpression of miR-449a ......" | 26934316 |