microRNA information: hsa-miR-451a
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-451a | miRbase |
Accession: | MIMAT0001631 | miRbase |
Precursor name: | hsa-mir-451a | miRbase |
Precursor accession: | MI0001729 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | AAACCGUUACCAUUACUGAGUU |
Reported expression in cancers: hsa-miR-451a
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-451a | bladder cancer | downregulation | "miR 451 inhibits invasion and proliferation of bla ......" | 25550801 | qPCR |
hsa-miR-451a | bladder cancer | downregulation | "Analysis of a microRNA miRNA expression signature ......" | 26057453 | RNA-Seq |
hsa-miR-451a | bladder cancer | downregulation | "It has been reported that miR-451 alters gene expr ......" | 27571748 | |
hsa-miR-451a | breast cancer | downregulation | "Tamoxifen downregulation of miR 451 increases 14 3 ......" | 21666713 | |
hsa-miR-451a | breast cancer | downregulation | "In this study we conducted miRNAs profile comparis ......" | 24788655 | Microarray; qPCR |
hsa-miR-451a | breast cancer | downregulation | "Real-time reverse transcription-polymerase chain r ......" | 26034677 | Reverse transcription PCR; qPCR |
hsa-miR-451a | colorectal cancer | downregulation | "The anti-tumor effects of miR-451 were further ver ......" | 26885274 | |
hsa-miR-451a | colorectal cancer | downregulation | "Then miR-451 expressions in these tissues were mea ......" | 27612504 | qPCR |
hsa-miR-451a | esophageal cancer | upregulation | "By Agilent microarray six deregulated miRNAs from ......" | 23560033 | Microarray; qPCR |
hsa-miR-451a | gastric cancer | downregulation | "MiR 451 a potential prognostic biomarker and tumor ......" | 26464660 | qPCR |
hsa-miR-451a | gastric cancer | upregulation | "High expression of miR 16 and miR 451 predicating ......" | 27605261 | Microarray; in situ hybridization |
hsa-miR-451a | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
hsa-miR-451a | liver cancer | downregulation | "miR 451 inhibits cell proliferation in human hepat ......" | 23740840 | |
hsa-miR-451a | liver cancer | downregulation | "In the present study miR-451 was found to be downr ......" | 24968707 | |
hsa-miR-451a | lung cancer | downregulation | "miR 126 3p and miR 451a correlate with clinicopath ......" | 27277197 | Microarray; Reverse transcription PCR |
hsa-miR-451a | lung squamous cell cancer | downregulation | "In this study we analyzed the miRNA expression pro ......" | 21358675 | Microarray |
hsa-miR-451a | lymphoma | deregulation | "In addition we derived an 11-miRNA signature 4 upr ......" | 23801630 | |
hsa-miR-451a | ovarian cancer | downregulation | "The aim of this study was to explore the effects o ......" | 26390704 | qPCR |
hsa-miR-451a | sarcoma | deregulation | "Expression profiles of 741 miRNAs were evaluated u ......" | 26299703 | qPCR |
hsa-miR-451a | thyroid cancer | upregulation | "Upregulation of miR 2861 and miR 451 expression in ......" | 23609190 | |
hsa-miR-451a | thyroid cancer | downregulation | "miR 451a is underexpressed and targets AKT/mTOR pa ......" | 26871295 | Microarray |
Reported cancer pathway affected by hsa-miR-451a
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-451a | bladder cancer | Apoptosis pathway | "miR 451 inhibits invasion and proliferation of bla ......" | 25550801 | Flow cytometry; Cell migration assay; Transwell assay; Western blot |
hsa-miR-451a | bladder cancer | Apoptosis pathway | "miR 451 suppresses bladder cancer cell migration a ......" | 27571748 | Luciferase |
hsa-miR-451a | breast cancer | Apoptosis pathway; MAPK signaling pathway | "Tamoxifen downregulation of miR 451 increases 14 3 ......" | 21666713 | Colony formation |
hsa-miR-451a | breast cancer | Apoptosis pathway | "Influence of MiR 451 on Drug Resistances of Paclit ......" | 26516138 | Western blot |
hsa-miR-451a | breast cancer | Apoptosis pathway | "Over expression of miR 451a can enhance the sensit ......" | 26896688 | MTT assay; Western blot |
hsa-miR-451a | colon cancer | Apoptosis pathway | "The expression profiles of miRNAs were examined in ......" | 26459459 | |
hsa-miR-451a | esophageal cancer | Apoptosis pathway | "Effect of miR 451 on the biological behavior of th ......" | 23053883 | Western blot; Colony formation; MTT assay; Transwell assay |
hsa-miR-451a | esophageal cancer | Apoptosis pathway | "MiR 451 inhibits proliferation of esophageal carci ......" | 26019450 | Western blot; Luciferase |
hsa-miR-451a | gastric cancer | Apoptosis pathway | "The effects of propofol on proliferation and apopt ......" | 27173190 | MTT assay; Western blot |
hsa-miR-451a | head and neck cancer | cell cycle pathway | "A global miRNA profiling was done on 51 formalin-f ......" | 20145181 | Flow cytometry |
hsa-miR-451a | kidney renal cell cancer | Apoptosis pathway | "Mir 451 Correlates with Prognosis of Renal Cell Ca ......" | 26779781 | Western blot; Luciferase |
hsa-miR-451a | lung cancer | Apoptosis pathway | "Previously we have identified microRNA miR-451 as ......" | 25026294 | |
hsa-miR-451a | lung squamous cell cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "Recently miR-451 as a tumor suppressor has been re ......" | 21329503 | Colony formation |
hsa-miR-451a | lung squamous cell cancer | PI3K/Akt signaling pathway; Apoptosis pathway | "In this study we analyzed the miRNA expression pro ......" | 21358675 | Colony formation; Luciferase; RNAi |
hsa-miR-451a | ovarian cancer | Apoptosis pathway | "The aim of this study was to explore the effects o ......" | 26390704 | |
hsa-miR-451a | sarcoma | cell cycle pathway; Apoptosis pathway | "MicroRNA expression profiles distinguish liposarco ......" | 24375455 | |
hsa-miR-451a | sarcoma | Apoptosis pathway | "Thus the aim of this study was to explore the effe ......" | 25471786 | Cell migration assay |
hsa-miR-451a | sarcoma | cell cycle pathway | "Quantitative polymerase chain reaction and Western ......" | 25869073 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-451a
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-451a | bladder cancer | staging; differentiation | "miR 451 inhibits invasion and proliferation of bla ......" | 25550801 | Flow cytometry; Cell migration assay; Transwell assay; Western blot |
hsa-miR-451a | bladder cancer | cell migration; tumorigenesis | "miR 451 suppresses bladder cancer cell migration a ......" | 27571748 | Luciferase |
hsa-miR-451a | breast cancer | poor survival; drug resistance | "Tamoxifen downregulation of miR 451 increases 14 3 ......" | 21666713 | Colony formation |
hsa-miR-451a | breast cancer | metastasis | "The expression of miRNAs in patients with primary ......" | 24846313 | |
hsa-miR-451a | breast cancer | drug resistance | "Influence of MiR 451 on Drug Resistances of Paclit ......" | 26516138 | Western blot |
hsa-miR-451a | breast cancer | drug resistance | "Over expression of miR 451a can enhance the sensit ......" | 26896688 | MTT assay; Western blot |
hsa-miR-451a | breast cancer | drug resistance; poor survival | "We aimed to explore the potential application of c ......" | 27062696 | MTT assay |
hsa-miR-451a | breast cancer | poor survival; drug resistance | "Then a panel of four miRNAs miR-451 miR-3200 miR-2 ......" | 27064979 | |
hsa-miR-451a | colon cancer | recurrence | "Groups of five patients with and without disease r ......" | 24400111 | |
hsa-miR-451a | colorectal cancer | drug resistance; recurrence | "The results showed that miR-451 was downregulated ......" | 21948564 | |
hsa-miR-451a | colorectal cancer | staging | "The Agilent Human miRNA Microarray V19.0 was used ......" | 25484364 | |
hsa-miR-451a | colorectal cancer | progression | "To identify the sequential alterations of miRNAs a ......" | 26692142 | |
hsa-miR-451a | colorectal cancer | staging | "miR 451 regulates FoxO3 nuclear accumulation throu ......" | 26885274 | Luciferase; Western blot |
hsa-miR-451a | colorectal cancer | recurrence; staging; progression | "Expression pattern of miR 451 and its target MIF m ......" | 27612504 | |
hsa-miR-451a | esophageal cancer | metastasis | "Effect of miR 451 on the biological behavior of th ......" | 23053883 | Western blot; Colony formation; MTT assay; Transwell assay |
hsa-miR-451a | esophageal cancer | staging; metastasis; differentiation | "In this study we performed a miRNA microarray to a ......" | 24272087 | |
hsa-miR-451a | esophageal cancer | staging | "The differential expression of serum miRNA was det ......" | 26722280 | |
hsa-miR-451a | gastric cancer | recurrence; worse prognosis | "Initial profiling using miR microarrays was perfor ......" | 22046085 | |
hsa-miR-451a | gastric cancer | cell migration | "miR 101 2 miR 125b 2 and miR 451a act as potential ......" | 26458815 | Western blot; Colony formation |
hsa-miR-451a | gastric cancer | worse prognosis; staging; metastasis; poor survival | "MiR 451 a potential prognostic biomarker and tumor ......" | 26464660 | |
hsa-miR-451a | gastric cancer | worse prognosis; staging; poor survival; tumor size; metastasis | "High expression of miR 16 and miR 451 predicating ......" | 27605261 | |
hsa-miR-451a | glioblastoma | differentiation | "MIR 451 and Imatinib mesylate inhibit tumor growth ......" | 18765229 | Luciferase |
hsa-miR-451a | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
hsa-miR-451a | kidney renal cell cancer | worse prognosis; poor survival | "Mir 451 Correlates with Prognosis of Renal Cell Ca ......" | 26779781 | Western blot; Luciferase |
hsa-miR-451a | lung cancer | drug resistance | "Previously we have identified microRNA miR-451 as ......" | 25026294 | |
hsa-miR-451a | lung cancer | metastasis | "MiR 451 suppresses cell proliferation and metastas ......" | 25150396 | MTT assay; Wound Healing Assay; Western blot; Luciferase |
hsa-miR-451a | lung cancer | metastasis | "MiR-451 was found to be significantly downregulate ......" | 25310895 | |
hsa-miR-451a | lung cancer | staging; metastasis | "miR 126 3p and miR 451a correlate with clinicopath ......" | 27277197 | |
hsa-miR-451a | lung cancer | drug resistance | "MiR-451 as a tumor suppressor has been evaluated i ......" | 27686452 | |
hsa-miR-451a | lung cancer | drug resistance | "We further demonstrated that Notch-1 mediates chem ......" | 27727250 | |
hsa-miR-451a | lung squamous cell cancer | staging; metastasis; differentiation; poor survival | "In this study we analyzed the miRNA expression pro ......" | 21358675 | Colony formation; Luciferase; RNAi |
hsa-miR-451a | melanoma | cell migration | "A novel miR 451a isomiR associated with amelanotyp ......" | 25237911 | |
hsa-miR-451a | ovarian cancer | drug resistance | "Furthermore we discuss several other microRNAs tha ......" | 20083225 | |
hsa-miR-451a | ovarian cancer | tumorigenesis; worse prognosis; staging; metastasis | "The aim of this study was to explore the effects o ......" | 26390704 | |
hsa-miR-451a | pancreatic cancer | staging | "The miRNAs expression profile of early stage was s ......" | 24785459 | |
hsa-miR-451a | sarcoma | drug resistance | "In addition higher expression of miR-451 and miR-1 ......" | 22350417 | |
hsa-miR-451a | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
hsa-miR-451a | sarcoma | progression | "MicroRNA expression profiles distinguish liposarco ......" | 24375455 | |
hsa-miR-451a | sarcoma | worse prognosis; metastasis; recurrence | "MiR 451 inhibits cell growth and invasion by targe ......" | 25391425 | Western blot; Luciferase |
hsa-miR-451a | sarcoma | tumorigenesis; staging; metastasis; drug resistance; poor survival | "Thus the aim of this study was to explore the effe ......" | 25471786 | Cell migration assay |
hsa-miR-451a | thyroid cancer | metastasis; progression; worse prognosis | "Upregulation of miR 2861 and miR 451 expression in ......" | 23609190 | |
hsa-miR-451a | thyroid cancer | staging | "miR 451a is underexpressed and targets AKT/mTOR pa ......" | 26871295 |
Reported gene related to hsa-miR-451a
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-451a | bladder cancer | MYC | "miR 451 suppresses bladder cancer cell migration a ......" | 27571748 |
hsa-miR-451a | lung cancer | MYC | "Silencing of c-Myc could phenocopy the effects of ......" | 25026294 |
hsa-miR-451a | lung cancer | MYC | "Furthermore c-Myc was significantly upregulated in ......" | 25310895 |
hsa-miR-451a | breast cancer | BCL2 | "Western blot was used for the detection of the pro ......" | 26516138 |
hsa-miR-451a | esophageal cancer | BCL2 | "The expression of miR-451 was analyzed by RT-PCR a ......" | 23053883 |
hsa-miR-451a | breast cancer | MIF | "The expression of miR-451a and the target gene mac ......" | 26161389 |
hsa-miR-451a | colorectal cancer | MIF | "Expression pattern of miR 451 and its target MIF m ......" | 27612504 |
hsa-miR-451a | ovarian cancer | MUC16 | "Low level of miR-451 was associated with advanced ......" | 26390704 |
hsa-miR-451a | ovarian cancer | MUC16 | "MiR-451 and miR-93 were also specific when analyze ......" | 24641401 |
hsa-miR-451a | kidney renal cell cancer | PSMB8 | "The interaction between miR-451 and PSMB8 was conf ......" | 26779781 |
hsa-miR-451a | lung cancer | PSMB8 | "And the protein expressions of PSMB8 and NOS2 were ......" | 25150396 |
hsa-miR-451a | lung cancer | TIMM8A | "MiR-451 as a tumor suppressor has been evaluated i ......" | 27686452 |
hsa-miR-451a | lung squamous cell cancer | TIMM8A | "However whether miR-451 can affect the sensitivity ......" | 21329503 |
hsa-miR-451a | colorectal cancer | ABCB1 | "Furthermore miR-451 restoration decreases expressi ......" | 21948564 |
hsa-miR-451a | colorectal cancer | ABCG4 | "Furthermore miR-451 restoration decreases expressi ......" | 21948564 |
hsa-miR-451a | chronic myeloid leukemia | ABL1 | "Following our observation of miR-451 downregulatio ......" | 21511335 |
hsa-miR-451a | liver cancer | ATF2 | "Further investigation of the molecular mechanisms ......" | 24968707 |
hsa-miR-451a | breast cancer | CASP3 | "Western blot was used for the detection of the pro ......" | 26516138 |
hsa-miR-451a | bladder cancer | CDH2 | "N-cadherin and vimentin were up-regulated signific ......" | 25550801 |
hsa-miR-451a | esophageal cancer | CDKN2D | "MiR 451 inhibits proliferation of esophageal carci ......" | 26019450 |
hsa-miR-451a | sarcoma | CXCL16 | "MiR 451 inhibits cell growth and invasion by targe ......" | 25391425 |
hsa-miR-451a | lung cancer | DSPP | "Thus these findings provided that in lung cancer c ......" | 27686452 |
hsa-miR-451a | breast cancer | EGFR | "Increasing the level of miR-451 by overexpression ......" | 21666713 |
hsa-miR-451a | breast cancer | ERBB2 | "Increasing the level of miR-451 by overexpression ......" | 21666713 |
hsa-miR-451a | breast cancer | ESR1 | "Over expression of miR 451a can enhance the sensit ......" | 26896688 |
hsa-miR-451a | lymphoma | FLT3LG | "The array indicated that miR-451 showed the greate ......" | 25019040 |
hsa-miR-451a | colorectal cancer | FOXO3 | "miR 451 regulates FoxO3 nuclear accumulation throu ......" | 26885274 |
hsa-miR-451a | lung cancer | JUN | "We further demonstrated that Notch-1 mediates chem ......" | 27727250 |
hsa-miR-451a | esophageal cancer | MAP3K1 | "MiR 451 inhibits proliferation of esophageal carci ......" | 26019450 |
hsa-miR-451a | lung cancer | MCL1 | "Exogenous expression of miR-451 level in A549/DPP ......" | 27686452 |
hsa-miR-451a | gastric cancer | MMP2 | "Furthermore miR-451 overexpression reduced MMP-2 p ......" | 27173190 |
hsa-miR-451a | thyroid cancer | NLN | "In the validation cohort the expression of either ......" | 23609190 |
hsa-miR-451a | lung cancer | NOS2 | "And the protein expressions of PSMB8 and NOS2 were ......" | 25150396 |
hsa-miR-451a | lung cancer | NOTCH1 | "We further demonstrated that Notch-1 mediates chem ......" | 27727250 |
hsa-miR-451a | colorectal cancer | PTGS2 | "We identified cyclooxygenase-2 COX-2 as an indirec ......" | 21948564 |
hsa-miR-451a | lung squamous cell cancer | RAB14 | "Interestingly ectopic miR-451 expression could sig ......" | 21358675 |
hsa-miR-451a | breast cancer | SLC13A5 | "We aimed to explore the potential application of c ......" | 27062696 |
hsa-miR-451a | glioblastoma | SMAD3 | "In addition we identified a target site for SMAD i ......" | 18765229 |
hsa-miR-451a | breast cancer | STAR | "Furthermore the selective ability of the SERM tamo ......" | 21666713 |
hsa-miR-451a | breast cancer | TAM | "To investigate the effects and mechanisms of miR-4 ......" | 26896688 |
hsa-miR-451a | lung cancer | TSC1 | "Ten genes were co-regulated by miR-126-3p and miR- ......" | 27277197 |
hsa-miR-451a | bladder cancer | VIM | "N-cadherin and vimentin were up-regulated signific ......" | 25550801 |
hsa-miR-451a | colorectal cancer | YWHAZ | "miR 451 regulates FoxO3 nuclear accumulation throu ......" | 26885274 |
Expression profile in cancer corhorts: