microRNA information: hsa-miR-452-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-452-5p | miRbase |
| Accession: | MIMAT0001635 | miRbase |
| Precursor name: | hsa-mir-452 | miRbase |
| Precursor accession: | MI0001733 | miRbase |
| Symbol: | MIR452 | HGNC |
| RefSeq ID: | NR_029973 | GenBank |
| Sequence: | AACUGUUUGCAGAGGAAACUGA |
Reported expression in cancers: hsa-miR-452-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-452-5p | colorectal cancer | downregulation | "Decreased miR 452 expression in human colorectal c ......" | 27323070 | qPCR |
| hsa-miR-452-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
| hsa-miR-452-5p | kidney renal cell cancer | deregulation | "This study aims to profile dysregulated microRNA m ......" | 25938468 | Microarray |
| hsa-miR-452-5p | liver cancer | upregulation | "We examined the transcript expression of miR-224 a ......" | 22459148 | |
| hsa-miR-452-5p | prostate cancer | downregulation | "Multiple tumor-suppressive miRNAs were downregulat ......" | 22719071 | |
| hsa-miR-452-5p | prostate cancer | downregulation | "MicroRNA-224 miR-224 and microRNA-452 miR-452 are ......" | 27070713 |
Reported cancer pathway affected by hsa-miR-452-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-452-5p | breast cancer | Apoptosis pathway | "In the present study microRNA-452 miR-452 was foun ......" | 25040964 | Western blot |
| hsa-miR-452-5p | colorectal cancer | Apoptosis pathway | "Decreased miR 452 expression in human colorectal c ......" | 27323070 | |
| hsa-miR-452-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 452 promotes tumorigenesis in hepatocellu ......" | 24381057 | |
| hsa-miR-452-5p | lung squamous cell cancer | Apoptosis pathway; Epithelial mesenchymal transition pathway | "Expression of microRNA 452 via adenoviral vector i ......" | 26718215 | |
| hsa-miR-452-5p | prostate cancer | cell cycle pathway | "GABRE∼miR-452∼miR-224 promoter methylation was ......" | 24737792 |
Reported cancer prognosis affected by hsa-miR-452-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-452-5p | breast cancer | drug resistance | "MicroRNA 452 contributes to the docetaxel resistan ......" | 24648265 | Flow cytometry; MTT assay; Western blot |
| hsa-miR-452-5p | breast cancer | drug resistance | "In the present study microRNA-452 miR-452 was foun ......" | 25040964 | Western blot |
| hsa-miR-452-5p | breast cancer | drug resistance | "MTT-cytotoxic miRNA microarray Real-time quantitat ......" | 25562151 | Western blot; Luciferase |
| hsa-miR-452-5p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
| hsa-miR-452-5p | colorectal cancer | progression; tumorigenesis; staging; tumor size; worse prognosis | "Decreased miR 452 expression in human colorectal c ......" | 27323070 | |
| hsa-miR-452-5p | glioblastoma | drug resistance; staging | "The SOX2 response program in glioblastoma multifor ......" | 21211035 | Colony formation |
| hsa-miR-452-5p | kidney papillary renal cell cancer | staging; poor survival | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-452-5p | kidney renal cell cancer | staging | "This study aims to profile dysregulated microRNA m ......" | 25938468 | |
| hsa-miR-452-5p | liver cancer | tumorigenesis | "MicroRNA 452 promotes tumorigenesis in hepatocellu ......" | 24381057 | |
| hsa-miR-452-5p | liver cancer | tumorigenesis; poor survival | "MicroRNA 452 promotes stem like cells of hepatocel ......" | 27058905 | |
| hsa-miR-452-5p | lung squamous cell cancer | metastasis; staging | "Up Regulation of MiR 452 Inhibits Metastasis of No ......" | 26316085 | Transwell assay; Western blot; Luciferase |
| hsa-miR-452-5p | lung squamous cell cancer | metastasis; poor survival | "Expression of microRNA 452 via adenoviral vector i ......" | 26718215 | |
| hsa-miR-452-5p | lung squamous cell cancer | worse prognosis; poor survival; metastasis; differentiation; tumor size | "Down regulation of miR 452 is associated with poor ......" | 27162664 | |
| hsa-miR-452-5p | prostate cancer | malignant trasformation; motility | "GABRE∼miR-452∼miR-224 promoter methylation was ......" | 24737792 | |
| hsa-miR-452-5p | prostate cancer | cell migration; poor survival; progression | "Regulation of E3 ubiquitin ligase 1 WWP1 by microR ......" | 27070713 | Luciferase |
Reported gene related to hsa-miR-452-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-452-5p | lung squamous cell cancer | BMI1 | "Up Regulation of MiR 452 Inhibits Metastasis of No ......" | 26316085 |
| hsa-miR-452-5p | liver cancer | CDKN1B | "Silencing CDKN1B by small interfering RNA resemble ......" | 24381057 |
| hsa-miR-452-5p | liver cancer | PCNA | "MicroRNA 452 promotes tumorigenesis in hepatocellu ......" | 24381057 |
| hsa-miR-452-5p | glioblastoma | SOX2 | "Using next generation sequencing we identified 105 ......" | 21211035 |
| hsa-miR-452-5p | liver cancer | SOX7 | "MicroRNA 452 promotes stem like cells of hepatocel ......" | 27058905 |
| hsa-miR-452-5p | liver cancer | TCF4 | "Further Sox7 was identified as the direct target o ......" | 27058905 |
| hsa-miR-452-5p | prostate cancer | WWP1 | "Regulation of E3 ubiquitin ligase 1 WWP1 by microR ......" | 27070713 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-452-5p | LIMCH1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD | MirTarget | TCGA BLCA -0.088; TCGA CESC -0.178; TCGA COAD -0.304; TCGA ESCA -0.167; TCGA HNSC -0.188; TCGA KIRC -0.194; TCGA LIHC -0.127; TCGA LUAD -0.095; TCGA LUSC -0.269; TCGA PAAD -0.28 |
hsa-miR-452-5p | KLF12 | 11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; STAD | MirTarget | TCGA BLCA -0.135; TCGA CESC -0.19; TCGA COAD -0.472; TCGA HNSC -0.152; TCGA KIRC -0.085; TCGA KIRP -0.129; TCGA LGG -0.147; TCGA LIHC -0.093; TCGA LUSC -0.132; TCGA OV -0.122; TCGA STAD -0.184 |
hsa-miR-452-5p | RAB11FIP2 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; STAD | MirTarget | TCGA BLCA -0.076; TCGA CESC -0.091; TCGA ESCA -0.18; TCGA HNSC -0.059; TCGA KIRC -0.19; TCGA KIRP -0.164; TCGA LGG -0.078; TCGA LUSC -0.107; TCGA OV -0.156; TCGA STAD -0.077 |
hsa-miR-452-5p | GARNL3 | 9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; OV; PAAD; PRAD | MirTarget | TCGA BLCA -0.228; TCGA BRCA -0.107; TCGA CESC -0.109; TCGA HNSC -0.091; TCGA KIRP -0.106; TCGA LGG -0.101; TCGA OV -0.097; TCGA PAAD -0.463; TCGA PRAD -0.085 |
hsa-miR-452-5p | TMEM47 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.095; TCGA CESC -0.294; TCGA COAD -0.168; TCGA ESCA -0.147; TCGA HNSC -0.232; TCGA KIRP -0.103; TCGA LIHC -0.189; TCGA LUSC -0.285; TCGA STAD -0.22; TCGA UCEC -0.115 |
hsa-miR-452-5p | POU6F1 | 12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.149; TCGA COAD -0.339; TCGA ESCA -0.117; TCGA HNSC -0.249; TCGA KIRP -0.111; TCGA LGG -0.152; TCGA LIHC -0.058; TCGA LUSC -0.123; TCGA PAAD -0.132; TCGA PRAD -0.078; TCGA SARC -0.087; TCGA STAD -0.184 |
hsa-miR-452-5p | NPHP1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUSC; OV; PAAD; SARC | MirTarget | TCGA BLCA -0.081; TCGA BRCA -0.145; TCGA CESC -0.229; TCGA ESCA -0.108; TCGA HNSC -0.242; TCGA KIRP -0.181; TCGA LUSC -0.174; TCGA OV -0.142; TCGA PAAD -0.213; TCGA SARC -0.073 |
hsa-miR-452-5p | NECAB1 | 12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.191; TCGA CESC -0.179; TCGA COAD -0.376; TCGA HNSC -0.353; TCGA KIRC -0.224; TCGA KIRP -0.412; TCGA LGG -0.146; TCGA LUSC -0.48; TCGA OV -0.174; TCGA PAAD -0.352; TCGA SARC -0.258; TCGA STAD -0.263 |
hsa-miR-452-5p | TMEM170B | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD | MirTarget | TCGA BLCA -0.095; TCGA CESC -0.106; TCGA ESCA -0.197; TCGA HNSC -0.272; TCGA KIRC -0.082; TCGA LGG -0.149; TCGA LUAD -0.078; TCGA LUSC -0.142; TCGA PAAD -0.28; TCGA PRAD -0.084 |
hsa-miR-452-5p | ARHGEF6 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; THCA; STAD | MirTarget | TCGA BLCA -0.152; TCGA CESC -0.117; TCGA COAD -0.265; TCGA ESCA -0.168; TCGA HNSC -0.233; TCGA LIHC -0.074; TCGA LUSC -0.384; TCGA THCA -0.162; TCGA STAD -0.191 |
hsa-miR-452-5p | RELN | 11 cancers: BLCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.418; TCGA CESC -0.31; TCGA COAD -0.451; TCGA KIRC -0.673; TCGA KIRP -0.996; TCGA LIHC -0.414; TCGA LUAD -0.172; TCGA LUSC -0.514; TCGA PRAD -0.381; TCGA SARC -0.244; TCGA STAD -0.274 |
hsa-miR-452-5p | SLC8A1 | 10 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUSC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.171; TCGA COAD -0.332; TCGA ESCA -0.171; TCGA KIRC -0.11; TCGA LIHC -0.127; TCGA LUSC -0.208; TCGA PAAD -0.406; TCGA SARC -0.259; TCGA THCA -0.24; TCGA STAD -0.266 |
hsa-miR-452-5p | SORBS2 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BLCA -0.234; TCGA CESC -0.529; TCGA COAD -0.234; TCGA ESCA -0.605; TCGA HNSC -0.24; TCGA LIHC -0.132; TCGA LUAD -0.249; TCGA LUSC -0.451; TCGA OV -0.204; TCGA PAAD -0.254; TCGA STAD -0.193; TCGA UCEC -0.271 |
hsa-miR-452-5p | MORN4 | 13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; OV; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.063; TCGA BRCA -0.153; TCGA CESC -0.162; TCGA HNSC -0.165; TCGA KIRC -0.235; TCGA KIRP -0.161; TCGA LGG -0.105; TCGA LIHC -0.105; TCGA OV -0.129; TCGA PAAD -0.365; TCGA PRAD -0.234; TCGA STAD -0.153; TCGA UCEC -0.058 |
hsa-miR-452-5p | ANK2 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.243; TCGA COAD -0.626; TCGA ESCA -0.274; TCGA HNSC -0.382; TCGA KIRC -0.541; TCGA LIHC -0.14; TCGA LUAD -0.09; TCGA LUSC -0.45; TCGA OV -0.187; TCGA PAAD -0.568; TCGA STAD -0.336 |
hsa-miR-452-5p | GPR173 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD | MirTarget | TCGA BLCA -0.128; TCGA CESC -0.349; TCGA COAD -0.305; TCGA ESCA -0.19; TCGA HNSC -0.265; TCGA KIRC -0.278; TCGA KIRP -0.32; TCGA LGG -0.195; TCGA PAAD -0.19 |
hsa-miR-452-5p | NAP1L5 | 9 cancers: BLCA; COAD; HNSC; KIRC; LGG; LIHC; LUSC; PAAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.134; TCGA COAD -0.221; TCGA HNSC -0.089; TCGA KIRC -0.22; TCGA LGG -0.117; TCGA LIHC -0.149; TCGA LUSC -0.144; TCGA PAAD -0.524; TCGA STAD -0.152 |
hsa-miR-452-5p | GFRA1 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LIHC; LUSC; STAD | MirTarget | TCGA BLCA -0.43; TCGA BRCA -0.6; TCGA COAD -0.505; TCGA ESCA -0.276; TCGA KIRP -0.357; TCGA LGG -0.343; TCGA LIHC -0.2; TCGA LUSC -0.353; TCGA STAD -0.409 |
hsa-miR-452-5p | ARHGAP15 | 9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUSC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.169; TCGA COAD -0.294; TCGA ESCA -0.133; TCGA HNSC -0.203; TCGA LIHC -0.084; TCGA LUSC -0.371; TCGA THCA -0.252; TCGA STAD -0.147; TCGA UCEC -0.098 |
hsa-miR-452-5p | TNRC6C | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PAAD | mirMAP | TCGA BLCA -0.068; TCGA BRCA -0.095; TCGA ESCA -0.056; TCGA HNSC -0.158; TCGA KIRC -0.056; TCGA KIRP -0.105; TCGA LGG -0.112; TCGA LIHC -0.057; TCGA LUAD -0.077; TCGA PAAD -0.188 |
hsa-miR-452-5p | PGR | 14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LIHC; LUSC; OV; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.129; TCGA BRCA -0.576; TCGA CESC -0.396; TCGA COAD -0.471; TCGA HNSC -0.423; TCGA KIRC -0.307; TCGA LGG -0.126; TCGA LIHC -0.199; TCGA LUSC -0.359; TCGA OV -0.264; TCGA PAAD -0.389; TCGA SARC -0.46; TCGA STAD -0.321; TCGA UCEC -0.666 |
hsa-miR-452-5p | YPEL1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD | mirMAP | TCGA BLCA -0.15; TCGA CESC -0.129; TCGA COAD -0.101; TCGA ESCA -0.169; TCGA HNSC -0.342; TCGA KIRP -0.155; TCGA LGG -0.112; TCGA LUSC -0.187; TCGA PAAD -0.158; TCGA PRAD -0.359 |
hsa-miR-452-5p | RUNDC3B | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BLCA -0.068; TCGA CESC -0.17; TCGA ESCA -0.135; TCGA HNSC -0.17; TCGA KIRP -0.406; TCGA LGG -0.059; TCGA LIHC -0.173; TCGA LUSC -0.187; TCGA OV -0.084; TCGA PAAD -0.443; TCGA UCEC -0.223 |
hsa-miR-452-5p | ASPA | 9 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUSC; STAD; UCEC | mirMAP | TCGA BLCA -0.159; TCGA COAD -0.493; TCGA ESCA -0.345; TCGA KIRP -0.232; TCGA LGG -0.17; TCGA LIHC -0.299; TCGA LUSC -0.449; TCGA STAD -0.37; TCGA UCEC -0.138 |
hsa-miR-452-5p | BVES | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.186; TCGA CESC -0.227; TCGA COAD -0.396; TCGA HNSC -0.137; TCGA KIRC -0.168; TCGA LIHC -0.137; TCGA LUSC -0.154; TCGA PAAD -0.195; TCGA SARC -0.161; TCGA STAD -0.276 |
hsa-miR-452-5p | PDE4D | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD | mirMAP; miRNATAP | TCGA BLCA -0.078; TCGA CESC -0.21; TCGA COAD -0.291; TCGA ESCA -0.144; TCGA HNSC -0.196; TCGA KIRC -0.11; TCGA KIRP -0.131; TCGA LGG -0.1; TCGA LIHC -0.095; TCGA LUAD -0.282; TCGA LUSC -0.161; TCGA SARC -0.125; TCGA STAD -0.303 |
hsa-miR-452-5p | LDB3 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.284; TCGA CESC -0.233; TCGA COAD -0.701; TCGA ESCA -0.185; TCGA HNSC -0.559; TCGA LGG -0.171; TCGA LUSC -0.252; TCGA PAAD -0.32; TCGA SARC -0.402; TCGA STAD -0.548; TCGA UCEC -0.142 |
hsa-miR-452-5p | ENTPD1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.11; TCGA CESC -0.06; TCGA COAD -0.114; TCGA ESCA -0.138; TCGA HNSC -0.108; TCGA LUSC -0.189; TCGA SARC -0.139; TCGA STAD -0.101; TCGA UCEC -0.057 |
hsa-miR-452-5p | KIAA1644 | 9 cancers: BLCA; COAD; LGG; LIHC; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.25; TCGA COAD -0.418; TCGA LGG -0.382; TCGA LIHC -0.239; TCGA LUSC -0.29; TCGA PAAD -0.343; TCGA SARC -0.304; TCGA THCA -0.19; TCGA STAD -0.446 |
hsa-miR-452-5p | GABRB2 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC | mirMAP | TCGA BLCA -0.127; TCGA BRCA -0.069; TCGA CESC -0.36; TCGA ESCA -0.356; TCGA HNSC -0.315; TCGA KIRC -0.576; TCGA LGG -0.336; TCGA LUAD -0.226; TCGA LUSC -0.219 |
hsa-miR-452-5p | RAB39B | 9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUSC; PAAD; STAD | mirMAP | TCGA BLCA -0.196; TCGA BRCA -0.133; TCGA COAD -0.259; TCGA HNSC -0.301; TCGA KIRC -0.279; TCGA LGG -0.091; TCGA LUSC -0.19; TCGA PAAD -0.732; TCGA STAD -0.181 |
hsa-miR-452-5p | BEND7 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PAAD | mirMAP | TCGA BLCA -0.12; TCGA CESC -0.213; TCGA ESCA -0.515; TCGA HNSC -0.369; TCGA KIRC -0.079; TCGA KIRP -0.16; TCGA LGG -0.087; TCGA LIHC -0.062; TCGA LUSC -0.188; TCGA OV -0.078; TCGA PAAD -0.167 |
hsa-miR-452-5p | DACH1 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; OV | mirMAP | TCGA BLCA -0.127; TCGA BRCA -0.511; TCGA CESC -0.424; TCGA ESCA -0.389; TCGA HNSC -0.153; TCGA KIRC -0.534; TCGA LGG -0.1; TCGA LIHC -0.306; TCGA LUAD -0.111; TCGA OV -0.436 |
hsa-miR-452-5p | KCNK3 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.38; TCGA CESC -0.337; TCGA COAD -0.508; TCGA ESCA -0.321; TCGA HNSC -0.304; TCGA LGG -0.504; TCGA LIHC -0.137; TCGA LUAD -0.156; TCGA LUSC -0.432; TCGA PAAD -0.894; TCGA SARC -0.422; TCGA STAD -0.34 |
hsa-miR-452-5p | KSR2 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PAAD | mirMAP | TCGA BLCA -0.243; TCGA BRCA -0.289; TCGA COAD -0.245; TCGA ESCA -0.218; TCGA KIRC -0.972; TCGA KIRP -0.186; TCGA LGG -0.555; TCGA LUSC -0.208; TCGA PAAD -0.486 |
hsa-miR-452-5p | ANO5 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.305; TCGA CESC -0.404; TCGA COAD -0.356; TCGA ESCA -0.67; TCGA HNSC -0.547; TCGA KIRC -1.002; TCGA KIRP -0.209; TCGA LGG -0.195; TCGA LUSC -0.407; TCGA PAAD -0.445; TCGA SARC -0.589; TCGA THCA -0.187; TCGA STAD -0.38 |
hsa-miR-452-5p | MLLT3 | 11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.084; TCGA BRCA -0.104; TCGA CESC -0.238; TCGA ESCA -0.184; TCGA HNSC -0.206; TCGA KIRC -0.102; TCGA KIRP -0.065; TCGA LGG -0.126; TCGA PRAD -0.119; TCGA STAD -0.083; TCGA UCEC -0.098 |
hsa-miR-452-5p | PLCXD3 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD | mirMAP | TCGA BLCA -0.282; TCGA CESC -0.431; TCGA COAD -0.798; TCGA ESCA -0.521; TCGA KIRC -0.655; TCGA LIHC -0.36; TCGA LUAD -0.144; TCGA LUSC -0.402; TCGA OV -0.349; TCGA PAAD -0.341 |
hsa-miR-452-5p | SBK1 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; OV; PRAD | mirMAP | TCGA BLCA -0.173; TCGA BRCA -0.257; TCGA CESC -0.169; TCGA HNSC -0.396; TCGA KIRC -0.46; TCGA KIRP -0.393; TCGA LGG -0.208; TCGA LUAD -0.148; TCGA OV -0.172; TCGA PRAD -0.48 |
hsa-miR-452-5p | ZNF470 | 9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; UCEC | mirMAP | TCGA BLCA -0.088; TCGA CESC -0.238; TCGA HNSC -0.255; TCGA KIRC -0.086; TCGA KIRP -0.128; TCGA LUSC -0.126; TCGA PAAD -0.264; TCGA PRAD -0.068; TCGA UCEC -0.062 |
hsa-miR-452-5p | ZNF583 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PAAD; PRAD | mirMAP | TCGA BLCA -0.069; TCGA CESC -0.384; TCGA ESCA -0.141; TCGA HNSC -0.334; TCGA KIRC -0.107; TCGA KIRP -0.067; TCGA LUSC -0.172; TCGA OV -0.069; TCGA PAAD -0.216; TCGA PRAD -0.147 |
hsa-miR-452-5p | SHISA9 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; OV; PAAD; STAD | mirMAP | TCGA BLCA -0.207; TCGA BRCA -0.174; TCGA CESC -0.424; TCGA HNSC -0.24; TCGA KIRP -0.164; TCGA LGG -0.174; TCGA LIHC -0.145; TCGA OV -0.277; TCGA PAAD -0.613; TCGA STAD -0.358 |
hsa-miR-452-5p | ANKS1B | 9 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUSC; OV; PAAD; SARC | miRNATAP | TCGA BLCA -0.235; TCGA BRCA -0.292; TCGA CESC -0.236; TCGA ESCA -0.155; TCGA LGG -0.234; TCGA LUSC -0.407; TCGA OV -0.155; TCGA PAAD -0.655; TCGA SARC -0.184 |
hsa-miR-452-5p | CDH2 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; OV; PAAD; SARC | miRNATAP | TCGA BLCA -0.249; TCGA BRCA -0.138; TCGA CESC -0.541; TCGA COAD -0.307; TCGA HNSC -0.28; TCGA KIRP -0.263; TCGA LUAD -0.31; TCGA LUSC -0.496; TCGA OV -0.317; TCGA PAAD -0.297; TCGA SARC -0.351 |
hsa-miR-452-5p | SYPL2 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; THCA; STAD | miRNATAP | TCGA BLCA -0.207; TCGA CESC -0.309; TCGA COAD -0.426; TCGA ESCA -0.26; TCGA HNSC -0.562; TCGA KIRC -0.322; TCGA KIRP -0.357; TCGA LIHC -0.167; TCGA LUSC -0.369; TCGA THCA -0.235; TCGA STAD -0.204 |
hsa-miR-452-5p | NOSTRIN | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUSC; UCEC | miRNATAP | TCGA BLCA -0.085; TCGA BRCA -0.174; TCGA CESC -0.327; TCGA ESCA -0.759; TCGA HNSC -0.24; TCGA KIRP -0.169; TCGA LIHC -0.13; TCGA LUSC -0.358; TCGA UCEC -0.103 |
hsa-miR-452-5p | RGMB | 9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; PAAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.05; TCGA BRCA -0.052; TCGA ESCA -0.108; TCGA HNSC -0.125; TCGA LGG -0.231; TCGA PAAD -0.157; TCGA SARC -0.096; TCGA STAD -0.248; TCGA UCEC -0.099 |
hsa-miR-452-5p | PDZRN3 | 10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; SARC; UCEC | miRNATAP | TCGA BLCA -0.268; TCGA CESC -0.161; TCGA COAD -0.271; TCGA HNSC -0.157; TCGA KIRC -0.369; TCGA KIRP -0.316; TCGA LIHC -0.304; TCGA LUSC -0.294; TCGA SARC -0.191; TCGA UCEC -0.121 |
hsa-miR-452-5p | ZNF692 | 9 cancers: BRCA; HNSC; KIRP; LGG; LUAD; OV; PRAD; SARC; THCA | MirTarget | TCGA BRCA -0.083; TCGA HNSC -0.119; TCGA KIRP -0.094; TCGA LGG -0.071; TCGA LUAD -0.094; TCGA OV -0.061; TCGA PRAD -0.409; TCGA SARC -0.14; TCGA THCA -0.092 |
hsa-miR-452-5p | ESRRG | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LIHC; OV; PAAD; STAD | MirTarget; mirMAP | TCGA BRCA -0.094; TCGA CESC -0.393; TCGA ESCA -0.436; TCGA HNSC -0.345; TCGA KIRC -0.802; TCGA LGG -0.177; TCGA LIHC -0.157; TCGA OV -0.208; TCGA PAAD -0.361; TCGA STAD -0.352 |
hsa-miR-452-5p | CASC1 | 10 cancers: BRCA; CESC; ESCA; KIRP; LUSC; OV; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.445; TCGA CESC -0.344; TCGA ESCA -0.309; TCGA KIRP -0.319; TCGA LUSC -0.41; TCGA OV -0.164; TCGA PAAD -0.507; TCGA SARC -0.147; TCGA STAD -0.193; TCGA UCEC -0.171 |
hsa-miR-452-5p | MZF1 | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; UCEC | MirTarget | TCGA BRCA -0.156; TCGA CESC -0.119; TCGA ESCA -0.097; TCGA HNSC -0.16; TCGA KIRP -0.103; TCGA LUAD -0.113; TCGA PAAD -0.215; TCGA PRAD -0.24; TCGA UCEC -0.125 |
hsa-miR-452-5p | TAPT1 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; PAAD; SARC; STAD | MirTarget | TCGA BRCA -0.141; TCGA CESC -0.074; TCGA COAD -0.062; TCGA ESCA -0.12; TCGA HNSC -0.076; TCGA KIRC -0.076; TCGA LGG -0.087; TCGA LIHC -0.111; TCGA LUSC -0.076; TCGA PAAD -0.116; TCGA SARC -0.063; TCGA STAD -0.077 |
hsa-miR-452-5p | CASD1 | 9 cancers: BRCA; CESC; COAD; HNSC; KIRP; LGG; LUSC; PAAD; PRAD | MirTarget; miRNATAP | TCGA BRCA -0.165; TCGA CESC -0.129; TCGA COAD -0.115; TCGA HNSC -0.094; TCGA KIRP -0.075; TCGA LGG -0.103; TCGA LUSC -0.111; TCGA PAAD -0.171; TCGA PRAD -0.096 |
hsa-miR-452-5p | RAB11FIP4 | 9 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LUSC; OV; PAAD; PRAD | MirTarget | TCGA BRCA -0.193; TCGA ESCA -0.294; TCGA KIRC -0.576; TCGA KIRP -0.094; TCGA LGG -0.214; TCGA LUSC -0.096; TCGA OV -0.113; TCGA PAAD -0.118; TCGA PRAD -0.069 |
hsa-miR-452-5p | WDR35 | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD | MirTarget | TCGA BRCA -0.105; TCGA CESC -0.12; TCGA ESCA -0.087; TCGA HNSC -0.065; TCGA KIRP -0.08; TCGA LUAD -0.058; TCGA LUSC -0.1; TCGA OV -0.137; TCGA PAAD -0.213 |
hsa-miR-452-5p | ASAH1 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; THCA; STAD | MirTarget | TCGA BRCA -0.102; TCGA CESC -0.088; TCGA COAD -0.129; TCGA ESCA -0.132; TCGA HNSC -0.086; TCGA KIRC -0.218; TCGA LIHC -0.064; TCGA LUSC -0.197; TCGA THCA -0.086; TCGA STAD -0.066 |
hsa-miR-452-5p | RABEP1 | 9 cancers: BRCA; CESC; COAD; KIRC; KIRP; LIHC; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.213; TCGA CESC -0.067; TCGA COAD -0.116; TCGA KIRC -0.122; TCGA KIRP -0.082; TCGA LIHC -0.077; TCGA PAAD -0.186; TCGA STAD -0.05; TCGA UCEC -0.055 |
hsa-miR-452-5p | KIAA1549 | 11 cancers: BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; OV; PAAD; UCEC | mirMAP | TCGA BRCA -0.085; TCGA CESC -0.328; TCGA ESCA -0.24; TCGA KIRC -0.078; TCGA KIRP -0.118; TCGA LGG -0.121; TCGA LIHC -0.126; TCGA LUAD -0.171; TCGA OV -0.229; TCGA PAAD -0.162; TCGA UCEC -0.068 |
hsa-miR-452-5p | LIMD1 | 9 cancers: BRCA; CESC; ESCA; KIRP; LUAD; LUSC; PRAD; STAD; UCEC | mirMAP | TCGA BRCA -0.09; TCGA CESC -0.085; TCGA ESCA -0.11; TCGA KIRP -0.067; TCGA LUAD -0.117; TCGA LUSC -0.067; TCGA PRAD -0.066; TCGA STAD -0.051; TCGA UCEC -0.068 |
hsa-miR-452-5p | UBXN10 | 9 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BRCA -0.386; TCGA CESC -0.719; TCGA ESCA -0.87; TCGA KIRP -0.146; TCGA LIHC -0.157; TCGA LUSC -0.604; TCGA OV -0.093; TCGA PAAD -0.247; TCGA UCEC -0.166 |
hsa-miR-452-5p | MAP9 | 9 cancers: BRCA; CESC; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PAAD | mirMAP | TCGA BRCA -0.116; TCGA CESC -0.375; TCGA HNSC -0.161; TCGA KIRC -0.264; TCGA KIRP -0.087; TCGA LIHC -0.151; TCGA LUSC -0.086; TCGA OV -0.077; TCGA PAAD -0.288 |
hsa-miR-452-5p | GRIK2 | 9 cancers: BRCA; CESC; COAD; KIRC; LGG; OV; PAAD; THCA; STAD | mirMAP; miRNATAP | TCGA BRCA -0.075; TCGA CESC -0.287; TCGA COAD -0.271; TCGA KIRC -0.719; TCGA LGG -0.268; TCGA OV -0.142; TCGA PAAD -0.674; TCGA THCA -0.608; TCGA STAD -0.236 |
hsa-miR-452-5p | ZNF33A | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; OV; PAAD | mirMAP | TCGA BRCA -0.073; TCGA CESC -0.087; TCGA ESCA -0.195; TCGA HNSC -0.061; TCGA KIRC -0.07; TCGA LGG -0.086; TCGA LUAD -0.092; TCGA LUSC -0.107; TCGA OV -0.072; TCGA PAAD -0.106 |
hsa-miR-452-5p | GLCCI1 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUSC; OV; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.102; TCGA CESC -0.176; TCGA ESCA -0.19; TCGA HNSC -0.137; TCGA KIRP -0.11; TCGA LGG -0.21; TCGA LUSC -0.229; TCGA OV -0.098; TCGA PAAD -0.166; TCGA STAD -0.118; TCGA UCEC -0.068 |
hsa-miR-452-5p | ACTR3B | 9 cancers: CESC; HNSC; KIRC; KIRP; LGG; LUAD; OV; PAAD; PRAD | MirTarget | TCGA CESC -0.156; TCGA HNSC -0.106; TCGA KIRC -0.189; TCGA KIRP -0.153; TCGA LGG -0.091; TCGA LUAD -0.066; TCGA OV -0.098; TCGA PAAD -0.12; TCGA PRAD -0.249 |
hsa-miR-452-5p | FNDC3A | 10 cancers: CESC; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD | MirTarget | TCGA CESC -0.212; TCGA ESCA -0.256; TCGA KIRC -0.107; TCGA KIRP -0.105; TCGA LIHC -0.111; TCGA LUAD -0.073; TCGA LUSC -0.161; TCGA OV -0.085; TCGA PAAD -0.228; TCGA STAD -0.1 |
hsa-miR-452-5p | PPP3CB | 9 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PAAD; STAD | MirTarget; miRNATAP | TCGA CESC -0.074; TCGA COAD -0.084; TCGA ESCA -0.057; TCGA HNSC -0.056; TCGA KIRC -0.118; TCGA LGG -0.101; TCGA LUSC -0.087; TCGA PAAD -0.195; TCGA STAD -0.099 |
hsa-miR-452-5p | GRAMD1B | 10 cancers: CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; THCA; STAD | mirMAP | TCGA CESC -0.438; TCGA COAD -0.384; TCGA ESCA -0.762; TCGA HNSC -0.187; TCGA KIRC -0.287; TCGA LGG -0.154; TCGA LUAD -0.125; TCGA LUSC -0.361; TCGA THCA -0.409; TCGA STAD -0.168 |
hsa-miR-452-5p | SEC14L5 | 9 cancers: CESC; HNSC; KIRC; KIRP; LGG; OV; PAAD; PRAD; UCEC | mirMAP | TCGA CESC -0.151; TCGA HNSC -0.19; TCGA KIRC -0.39; TCGA KIRP -0.143; TCGA LGG -0.261; TCGA OV -0.19; TCGA PAAD -0.592; TCGA PRAD -0.262; TCGA UCEC -0.255 |
hsa-miR-452-5p | MTMR9 | 9 cancers: CESC; COAD; ESCA; KIRC; LGG; LIHC; PAAD; SARC; STAD | mirMAP | TCGA CESC -0.088; TCGA COAD -0.179; TCGA ESCA -0.067; TCGA KIRC -0.094; TCGA LGG -0.102; TCGA LIHC -0.088; TCGA PAAD -0.129; TCGA SARC -0.052; TCGA STAD -0.106 |
hsa-miR-452-5p | ABI2 | 11 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; OV; PAAD; SARC; STAD | mirMAP | TCGA CESC -0.081; TCGA ESCA -0.074; TCGA HNSC -0.12; TCGA KIRC -0.125; TCGA KIRP -0.051; TCGA LGG -0.096; TCGA LUSC -0.069; TCGA OV -0.067; TCGA PAAD -0.116; TCGA SARC -0.106; TCGA STAD -0.069 |
hsa-miR-452-5p | FZD4 | 9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; STAD | miRNATAP | TCGA CESC -0.315; TCGA COAD -0.166; TCGA ESCA -0.324; TCGA HNSC -0.214; TCGA KIRP -0.218; TCGA LUAD -0.102; TCGA LUSC -0.316; TCGA PRAD -0.101; TCGA STAD -0.103 |
hsa-miR-452-5p | HS3ST1 | 9 cancers: COAD; ESCA; KIRC; KIRP; LIHC; PRAD; THCA; STAD; UCEC | mirMAP | TCGA COAD -0.121; TCGA ESCA -0.214; TCGA KIRC -0.107; TCGA KIRP -0.225; TCGA LIHC -0.125; TCGA PRAD -0.157; TCGA THCA -0.192; TCGA STAD -0.139; TCGA UCEC -0.156 |
hsa-miR-452-5p | NTN4 | 9 cancers: COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUSC; THCA; STAD | miRNATAP | TCGA COAD -0.205; TCGA ESCA -0.337; TCGA HNSC -0.195; TCGA KIRC -0.317; TCGA LGG -0.116; TCGA LIHC -0.187; TCGA LUSC -0.326; TCGA THCA -0.304; TCGA STAD -0.19 |
hsa-miR-452-5p | PRKAR2B | 11 cancers: COAD; HNSC; KIRC; LGG; LIHC; LUSC; OV; PAAD; SARC; THCA; STAD | miRNATAP | TCGA COAD -0.355; TCGA HNSC -0.252; TCGA KIRC -0.485; TCGA LGG -0.122; TCGA LIHC -0.226; TCGA LUSC -0.143; TCGA OV -0.075; TCGA PAAD -0.276; TCGA SARC -0.207; TCGA THCA -0.174; TCGA STAD -0.241 |
Enriched cancer pathways of putative targets