microRNA information: hsa-miR-483-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-483-3p | miRbase |
Accession: | MIMAT0002173 | miRbase |
Precursor name: | hsa-mir-483 | miRbase |
Precursor accession: | MI0002467 | miRbase |
Symbol: | MIR483 | HGNC |
RefSeq ID: | NR_030158 | GenBank |
Sequence: | UCACUCCUCUCCUCCCGUCUU |
Reported expression in cancers: hsa-miR-483-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-483-3p | esophageal cancer | upregulation | "Prediction value of miR 483 and miR 214 in prognos ......" | 23721345 | qPCR |
hsa-miR-483-3p | gastric cancer | downregulation | "High Throughput miRNA Sequencing Reveals a Field E ......" | 26244015 | RNA-Seq |
hsa-miR-483-3p | liver cancer | deregulation | "In this study we identified 10 upregulated miRNAs ......" | 22362728 | qPCR |
hsa-miR-483-3p | liver cancer | deregulation | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Microarray; Reverse transcription PCR |
hsa-miR-483-3p | lung cancer | deregulation | "MiRNA profiles were obtained using microarray and ......" | 25359683 | qPCR; Microarray |
hsa-miR-483-3p | pancreatic cancer | upregulation | "Circulating miR 483 3p and miR 21 is highly expres ......" | 25384963 | qPCR |
Reported cancer pathway affected by hsa-miR-483-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-483-3p | esophageal cancer | cell cycle pathway | "miR 483 3p plays an oncogenic role in esophageal s ......" | 26801660 | Western blot; Luciferase |
hsa-miR-483-3p | liver cancer | Apoptosis pathway | "Over expression of the miR 483 3p overcomes the mi ......" | 27120784 |
Reported cancer prognosis affected by hsa-miR-483-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-483-3p | breast cancer | malignant trasformation; progression | "Identification of featured biomarkers in breast ca ......" | 27365106 | |
hsa-miR-483-3p | esophageal cancer | worse prognosis; drug resistance; poor survival | "Prediction value of miR 483 and miR 214 in prognos ......" | 23721345 | |
hsa-miR-483-3p | esophageal cancer | worse prognosis; drug resistance; progression | "miR 483 3p plays an oncogenic role in esophageal s ......" | 26801660 | Western blot; Luciferase |
hsa-miR-483-3p | liver cancer | drug resistance | "Over expression of the miR 483 3p overcomes the mi ......" | 27120784 | |
hsa-miR-483-3p | lung cancer | metastasis | "miR 483 5p promotes invasion and metastasis of lun ......" | 24710410 | |
hsa-miR-483-3p | pancreatic cancer | staging | "In addition from 10 to 50 weeks of age stage-speci ......" | 26516699 |
Reported gene related to hsa-miR-483-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-483-3p | colorectal cancer | IGF2 | "IGF2 derived miR 483 mediated oncofunction by supp ......" | 27366946 |
hsa-miR-483-3p | liver cancer | IGF2 | "Igf2 derived intronic miR 483 promotes mouse hepat ......" | 22052201 |
hsa-miR-483-3p | esophageal cancer | AKR1B1 | "Downregulation of miR-483 and miR-214 could confer ......" | 23721345 |
hsa-miR-483-3p | lung cancer | ALCAM | "miR 483 5p promotes invasion and metastasis of lun ......" | 24710410 |
hsa-miR-483-3p | esophageal cancer | BSG | "SNP at miR 483 5p binding site in the 3' untransla ......" | 27420938 |
hsa-miR-483-3p | esophageal cancer | EI24 | "miR 483 3p plays an oncogenic role in esophageal s ......" | 26801660 |
hsa-miR-483-3p | liver cancer | SOCS3 | "The effect of miR-483 on Socs3 expression was exam ......" | 22052201 |
hsa-miR-483-3p | liver cancer | TP53 | "Here we demonstrate that in HCC cells carrying wil ......" | 27120784 |
Expression profile in cancer corhorts: