microRNA information: hsa-miR-485-3p

SectionIDlink
Mature name: hsa-miR-485-3pmiRbase
Accession: MIMAT0002176miRbase
Precursor name: hsa-mir-485 miRbase
Precursor accession: MI0002469miRbase
Symbol: MIR485HGNC
RefSeq ID: NR_030160GenBank
Sequence: GUCAUACACGGCUCUCCUCUCU



Reported expression in cancers: hsa-miR-485-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-485-3p

lung cancerdownregulation"In this study we found that the expression level o ......"27262438



Reported cancer pathway affected by hsa-miR-485-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-485-3p

lung cancermTOR signaling pathway"MiR 485 inhibits metastasis and EMT of lung adenoc ......"27262438Luciferase
hsa-miR-485-3p

prostate cancerApoptosis pathway"MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......"24166498



Reported cancer prognosis affected by hsa-miR-485-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-485-3p

breast cancercell migration"miR 485 acts as a tumor suppressor by inhibiting c ......"23886178Colony formation; Cell migration assay
hsa-miR-485-3p

breast cancermetastasis; cell migration"MiR 485 3p and miR 485 5p suppress breast cancer c ......"27010860
hsa-miR-485-3p

gastric cancerprogression"miR 485 5p acts as a negative regulator in gastric ......"26807169
hsa-miR-485-3p

gastric cancerworse prognosis"Reduced miR 485 5p expression predicts poor progno ......"27160123
hsa-miR-485-3p

liver cancermetastasis; tumorigenesis"Expression of miR-664 miR-485-3p and miR-495 poten ......"23241961
hsa-miR-485-3p

liver cancerprogression"Involvement of miR 485 5p in hepatocellular carcin ......"26054676
hsa-miR-485-3p

lung cancermetastasis; progression"MiR 485 inhibits metastasis and EMT of lung adenoc ......"27262438Luciferase
hsa-miR-485-3p

prostate cancerpoor survival; drug resistance"Fludarabine treatment favors the retention of miR ......"23734815



Reported gene related to hsa-miR-485-3p

miRNAcancergenereportingPUBMED
hsa-miR-485-3p

liver cancerBSG"Involvement of miR 485 5p in hepatocellular carcin ......"26054676
hsa-miR-485-3p

prostate cancerCCNB2"As a possible mechanism we suggest that fludarabin ......"23734815
hsa-miR-485-3p

gastric cancerFLOT1"miR 485 5p acts as a negative regulator in gastric ......"26807169
hsa-miR-485-3p

lung cancerFLOT2"MiR 485 inhibits metastasis and EMT of lung adenoc ......"27262438
hsa-miR-485-3p

breast cancerHPGD"miR 485 5p binding site SNP rs8752 in HPGD gene is ......"25003827
hsa-miR-485-3p

prostate cancerPCNA"As a possible mechanism we suggest that fludarabin ......"23734815



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-485-3p
GPD1L
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.217; TCGA CESC -0.074; TCGA ESCA -0.275; TCGA HNSC -0.113; TCGA LUAD -0.083; TCGA LUSC -0.136; TCGA PRAD -0.122; TCGA STAD -0.219; TCGA UCEC -0.059
hsa-miR-485-3p
CD46
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; UCEC
MirTarget
TCGA BLCA -0.115; TCGA BRCA -0.109; TCGA COAD -0.152; TCGA ESCA -0.104; TCGA HNSC -0.057; TCGA LUAD -0.087; TCGA LUSC -0.056; TCGA PRAD -0.093; TCGA UCEC -0.085
hsa-miR-485-3p
PYROXD1
10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.098; TCGA BRCA -0.053; TCGA COAD -0.089; TCGA HNSC -0.056; TCGA LUAD -0.058; TCGA LUSC -0.099; TCGA OV -0.087; TCGA PRAD -0.057; TCGA STAD -0.098; TCGA UCEC -0.07
hsa-miR-485-3p
FCHO2
9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; PRAD; STAD; UCEC
PITA
TCGA BLCA -0.07; TCGA COAD -0.066; TCGA ESCA -0.152; TCGA HNSC -0.115; TCGA LGG -0.074; TCGA LUSC -0.098; TCGA PRAD -0.083; TCGA STAD -0.131; TCGA UCEC -0.092
hsa-miR-485-3p
EMP2
10 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; UCEC
mirMAP
TCGA BLCA -0.086; TCGA BRCA -0.058; TCGA CESC -0.112; TCGA HNSC -0.167; TCGA LIHC -0.076; TCGA LUAD -0.075; TCGA LUSC -0.227; TCGA PAAD -0.254; TCGA PRAD -0.107; TCGA UCEC -0.083
hsa-miR-485-3p
OCLN
9 cancers: BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
mirMAP
TCGA BRCA -0.128; TCGA COAD -0.094; TCGA ESCA -0.326; TCGA HNSC -0.418; TCGA LUAD -0.065; TCGA LUSC -0.237; TCGA PAAD -0.194; TCGA PRAD -0.126; TCGA UCEC -0.127
hsa-miR-485-3p
RBM47
10 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; UCEC
miRNATAP
TCGA BRCA -0.149; TCGA CESC -0.084; TCGA ESCA -0.311; TCGA HNSC -0.262; TCGA LGG -0.128; TCGA LUAD -0.051; TCGA LUSC -0.148; TCGA PAAD -0.137; TCGA PRAD -0.138; TCGA UCEC -0.122





Enriched cancer pathways of putative targets