microRNA information: hsa-miR-486-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-486-5p | miRbase |
Accession: | MIMAT0002177 | miRbase |
Precursor name: | hsa-mir-486-1 | miRbase |
Precursor accession: | MI0002470 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | UCCUGUACUGAGCUGCCCCGAG |
Reported expression in cancers: hsa-miR-486-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-486-5p | breast cancer | downregulation | "Recently miR-486-5p has been proved to play an imp ......" | 25104088 | |
hsa-miR-486-5p | colorectal cancer | downregulation | "Despite ample research revealing the dysregualtion ......" | 27284245 | qPCR |
hsa-miR-486-5p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
hsa-miR-486-5p | gastric cancer | downregulation | "Using Agilent miRNA microarrays we compared miRNA ......" | 21415212 | Microarray |
hsa-miR-486-5p | liver cancer | downregulation | "In previous studies conducted in our laboratory th ......" | 25475121 | RNA-Seq |
hsa-miR-486-5p | lung cancer | downregulation | "We have previously shown that miR-486-5p is one of ......" | 23474761 | |
hsa-miR-486-5p | lung cancer | downregulation | "Here we conducted global profiling for miRNAs in a ......" | 23980150 | |
hsa-miR-486-5p | lung squamous cell cancer | downregulation | "Expression of ten miRNAs in the plasma and tumor s ......" | 26237047 | qPCR |
hsa-miR-486-5p | lung squamous cell cancer | downregulation | "Expression profile analysis of microRNAs and downr ......" | 26238736 | Microarray |
hsa-miR-486-5p | lung squamous cell cancer | downregulation | "In this study we found that miR-486-5p was signifi ......" | 27049724 | |
hsa-miR-486-5p | prostate cancer | deregulation | "Expression profile analysis of microRNAs in prosta ......" | 25597612 | RNA-Seq; qPCR |
hsa-miR-486-5p | thyroid cancer | downregulation | "Previous studies have demonstrated that miR-486-5p ......" | 27133060 |
Reported cancer pathway affected by hsa-miR-486-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-486-5p | breast cancer | Apoptosis pathway | "Recently miR-486-5p has been proved to play an imp ......" | 25104088 | |
hsa-miR-486-5p | lung squamous cell cancer | cell cycle pathway | "Direct repression of the oncogene CDK4 by the tumo ......" | 27049724 | |
hsa-miR-486-5p | thyroid cancer | Apoptosis pathway | "miR 486 5p inhibits cell growth of papillary thyro ......" | 27133060 |
Reported cancer prognosis affected by hsa-miR-486-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-486-5p | breast cancer | staging | "Quantitative RT-PCR was used to determine expressi ......" | 23526361 | |
hsa-miR-486-5p | breast cancer | malignant trasformation | "In support of these findings in vitro functional s ......" | 24104550 | |
hsa-miR-486-5p | breast cancer | metastasis | "Differential expression of miR 139 miR 486 and miR ......" | 25027758 | |
hsa-miR-486-5p | breast cancer | metastasis | "These included miR-141 miR-144 miR-193b miR-200a m ......" | 26785733 | |
hsa-miR-486-5p | cervical and endocervical cancer | metastasis | "MiR 486 3p targeting ECM1 represses cell prolifera ......" | 27133046 | |
hsa-miR-486-5p | colorectal cancer | staging | "miR 486 5p attenuates tumor growth and lymphangiog ......" | 27284245 | Luciferase |
hsa-miR-486-5p | endometrial cancer | malignant trasformation | "Expression profiling of normal and malignant endom ......" | 20028871 | |
hsa-miR-486-5p | esophageal cancer | worse prognosis | "miR 486 5p expression pattern in esophageal squamo ......" | 26895105 | |
hsa-miR-486-5p | gastric cancer | progression | "Genomic loss of miR 486 regulates tumor progressio ......" | 21415212 | Luciferase |
hsa-miR-486-5p | gastric cancer | poor survival; staging; metastasis; differentiation | "Then we further investigated these GC specific miR ......" | 27173517 | |
hsa-miR-486-5p | gastric cancer | staging | "In our previous study a panel of five circulating ......" | 27605261 | |
hsa-miR-486-5p | glioblastoma | differentiation | "We examined the microRNA profiles of Glioblastoma ......" | 18765229 | |
hsa-miR-486-5p | kidney renal cell cancer | staging; worse prognosis | "Expression of miR 486 is a potential prognostic fa ......" | 24649153 | |
hsa-miR-486-5p | liver cancer | recurrence; progression | "In previous studies conducted in our laboratory th ......" | 25475121 | Western blot; Luciferase |
hsa-miR-486-5p | liver cancer | staging | "In the discovery stage 2 serum samples pooled from ......" | 25962820 | |
hsa-miR-486-5p | liver cancer | recurrence; poor survival | "In the present study TaqMan Real-time PCR microRNA ......" | 26176380 | |
hsa-miR-486-5p | lung cancer | malignant trasformation | "In the training set miR-21 and miR-210 display hig ......" | 21864403 | |
hsa-miR-486-5p | lung cancer | metastasis; progression; cell migration; tumorigenesis; staging | "Downregulation of miR 486 5p contributes to tumor ......" | 23474761 | Luciferase |
hsa-miR-486-5p | lung cancer | staging | "Here we conducted global profiling for miRNAs in a ......" | 23980150 | |
hsa-miR-486-5p | lung cancer | tumorigenesis; drug resistance; poor survival | "Pim 1 kinase is a target of miR 486 5p and eukaryo ......" | 25342548 | Western blot; Luciferase |
hsa-miR-486-5p | lung squamous cell cancer | staging; poor survival | "In the discovery stage Solexa sequencing followed ......" | 20194856 | |
hsa-miR-486-5p | lung squamous cell cancer | poor survival; recurrence; drug resistance; staging | "Expression of ten miRNAs in the plasma and tumor s ......" | 26237047 | |
hsa-miR-486-5p | lung squamous cell cancer | progression | "Direct repression of the oncogene CDK4 by the tumo ......" | 27049724 | |
hsa-miR-486-5p | ovarian cancer | malignant trasformation; progression; tumorigenesis | "Estrogen receptor mediated miR 486 5p regulation o ......" | 26871282 | |
hsa-miR-486-5p | sarcoma | metastasis; poor survival; tumorigenesis | "TLS CHOP represses miR 486 expression inducing upr ......" | 22995304 |
Reported gene related to hsa-miR-486-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-486-5p | gastric cancer | OLFM4 | "Genomic loss of miR 486 regulates tumor progressio ......" | 21415212 |
hsa-miR-486-5p | ovarian cancer | OLFM4 | "Estrogen receptor mediated miR 486 5p regulation o ......" | 26871282 |
hsa-miR-486-5p | liver cancer | AFP | "Multivariate analysis demonstrated that miR-486-5p ......" | 26176380 |
hsa-miR-486-5p | glioblastoma | AMACR | "Nineteen and 26 microRNAs exhibited cohort-depende ......" | 21737610 |
hsa-miR-486-5p | lung cancer | ARHGAP5 | "Downregulation of miR 486 5p contributes to tumor ......" | 23474761 |
hsa-miR-486-5p | lung squamous cell cancer | CDK4 | "Direct repression of the oncogene CDK4 by the tumo ......" | 27049724 |
hsa-miR-486-5p | cervical and endocervical cancer | ECM1 | "MiR 486 3p targeting ECM1 represses cell prolifera ......" | 27133046 |
hsa-miR-486-5p | lung cancer | EIF4E | "The downregulated miR-486-5p and upregulated eIF4E ......" | 25342548 |
hsa-miR-486-5p | ovarian cancer | ESR1 | "Estrogen receptor mediated miR 486 5p regulation o ......" | 26871282 |
hsa-miR-486-5p | thyroid cancer | FBN1 | "miR 486 5p inhibits cell growth of papillary thyro ......" | 27133060 |
hsa-miR-486-5p | lung cancer | FMOD | "This method exhibits ultrahigh sensitivity toward ......" | 24215456 |
hsa-miR-486-5p | liver cancer | FRTS1 | "Multivariate analysis demonstrated that miR-486-5p ......" | 26176380 |
hsa-miR-486-5p | sarcoma | HCCS | "In this study we have found that miR-486 expressio ......" | 22995304 |
hsa-miR-486-5p | colorectal cancer | NRP2 | "miR 486 5p attenuates tumor growth and lymphangiog ......" | 27284245 |
hsa-miR-486-5p | liver cancer | PIK3R1 | "Mechanistically miR-486-5p was confirmed to direct ......" | 25475121 |
hsa-miR-486-5p | lung cancer | PIM1 | "Pim 1 kinase is a target of miR 486 5p and eukaryo ......" | 25342548 |
hsa-miR-486-5p | sarcoma | SERPINE1 | "Collectively these results suggest a novel essenti ......" | 22995304 |
hsa-miR-486-5p | gastric cancer | TECRL | "Bioinformatic analysis identified the secreted ant ......" | 21415212 |
hsa-miR-486-5p | lung cancer | TP53 | "Our findings support the role for miR-486 loss in ......" | 23980150 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-486-5p | GPX8 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD | MirTarget; miRanda | TCGA BLCA -0.126; TCGA BRCA -0.094; TCGA COAD -0.123; TCGA ESCA -0.172; TCGA HNSC -0.102; TCGA LIHC -0.094; TCGA LUAD -0.061; TCGA LUSC -0.106; TCGA PAAD -0.112; TCGA STAD -0.152 |
hsa-miR-486-5p | MOXD1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; PRAD; STAD; UCEC | miRanda | TCGA BLCA -0.305; TCGA BRCA -0.114; TCGA CESC -0.135; TCGA COAD -0.339; TCGA ESCA -0.355; TCGA KIRC -0.335; TCGA KIRP -0.161; TCGA LIHC -0.207; TCGA PRAD -0.104; TCGA STAD -0.268; TCGA UCEC -0.198 |
hsa-miR-486-5p | TMOD1 | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; SARC; STAD | miRanda; miRNATAP | TCGA BLCA -0.114; TCGA CESC -0.144; TCGA COAD -0.109; TCGA ESCA -0.163; TCGA KIRC -0.073; TCGA KIRP -0.098; TCGA LGG -0.054; TCGA SARC -0.315; TCGA STAD -0.139 |
hsa-miR-486-5p | CTSK | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; STAD; UCEC | miRanda | TCGA BLCA -0.299; TCGA CESC -0.08; TCGA COAD -0.14; TCGA ESCA -0.176; TCGA HNSC -0.149; TCGA LIHC -0.189; TCGA LUAD -0.077; TCGA LUSC -0.095; TCGA STAD -0.114; TCGA UCEC -0.186 |
hsa-miR-486-5p | CORIN | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.251; TCGA BRCA -0.361; TCGA COAD -0.318; TCGA ESCA -0.343; TCGA HNSC -0.195; TCGA KIRC -0.112; TCGA KIRP -0.082; TCGA PAAD -0.193; TCGA THCA -0.074; TCGA STAD -0.448; TCGA UCEC -0.11 |
hsa-miR-486-5p | COL16A1 | 9 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; STAD; UCEC | miRanda | TCGA BLCA -0.28; TCGA ESCA -0.179; TCGA HNSC -0.082; TCGA KIRC -0.122; TCGA KIRP -0.092; TCGA LIHC -0.162; TCGA LUSC -0.146; TCGA STAD -0.201; TCGA UCEC -0.191 |
hsa-miR-486-5p | ITGBL1 | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; STAD; UCEC | miRanda | TCGA BLCA -0.43; TCGA BRCA -0.111; TCGA CESC -0.164; TCGA COAD -0.476; TCGA ESCA -0.646; TCGA HNSC -0.268; TCGA PAAD -0.157; TCGA STAD -0.663; TCGA UCEC -0.13 |
hsa-miR-486-5p | PMEPA1 | 12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; PAAD; PRAD; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.16; TCGA COAD -0.227; TCGA ESCA -0.153; TCGA HNSC -0.146; TCGA KIRP -0.156; TCGA LIHC -0.217; TCGA LUAD -0.06; TCGA PAAD -0.139; TCGA PRAD -0.157; TCGA THCA -0.156; TCGA STAD -0.254; TCGA UCEC -0.073 |
hsa-miR-486-5p | TNFSF4 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.277; TCGA BRCA -0.197; TCGA COAD -0.165; TCGA ESCA -0.258; TCGA HNSC -0.262; TCGA LIHC -0.155; TCGA LUAD -0.09; TCGA LUSC -0.103; TCGA PRAD -0.089; TCGA THCA -0.119; TCGA STAD -0.261 |
hsa-miR-486-5p | CERCAM | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD | miRanda | TCGA BLCA -0.108; TCGA BRCA -0.109; TCGA COAD -0.147; TCGA ESCA -0.15; TCGA HNSC -0.162; TCGA KIRP -0.15; TCGA LIHC -0.135; TCGA LUAD -0.152; TCGA LUSC -0.169; TCGA STAD -0.123 |
hsa-miR-486-5p | PSD | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; THCA; STAD; UCEC | miRanda; miRNATAP | TCGA BLCA -0.338; TCGA BRCA -0.13; TCGA CESC -0.148; TCGA COAD -0.362; TCGA HNSC -0.129; TCGA KIRC -0.174; TCGA KIRP -0.115; TCGA LUSC -0.095; TCGA THCA -0.216; TCGA STAD -0.287; TCGA UCEC -0.277 |
hsa-miR-486-5p | BGN | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC | miRanda | TCGA BLCA -0.253; TCGA BRCA -0.213; TCGA CESC -0.102; TCGA COAD -0.184; TCGA ESCA -0.25; TCGA HNSC -0.177; TCGA KIRP -0.146; TCGA LUAD -0.053; TCGA PRAD -0.076; TCGA SARC -0.132; TCGA THCA -0.08; TCGA STAD -0.398; TCGA UCEC -0.138 |
hsa-miR-486-5p | STRA6 | 13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRanda | TCGA BLCA -0.253; TCGA BRCA -0.339; TCGA COAD -0.286; TCGA ESCA -0.372; TCGA HNSC -0.301; TCGA KIRC -0.375; TCGA LIHC -0.33; TCGA LUAD -0.326; TCGA LUSC -0.503; TCGA PAAD -0.238; TCGA PRAD -0.12; TCGA THCA -0.788; TCGA STAD -0.558 |
hsa-miR-486-5p | PRRX1 | 9 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; STAD; UCEC | miRanda | TCGA BLCA -0.298; TCGA COAD -0.178; TCGA ESCA -0.253; TCGA LGG -0.073; TCGA LIHC -0.263; TCGA LUAD -0.063; TCGA LUSC -0.085; TCGA STAD -0.303; TCGA UCEC -0.119 |
hsa-miR-486-5p | NUDT10 | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; UCEC | miRanda | TCGA BLCA -0.178; TCGA BRCA -0.106; TCGA CESC -0.162; TCGA COAD -0.301; TCGA HNSC -0.151; TCGA KIRC -0.342; TCGA KIRP -0.178; TCGA LUSC -0.202; TCGA UCEC -0.198 |
hsa-miR-486-5p | ST6GALNAC5 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; THCA; STAD | miRanda | TCGA BLCA -0.318; TCGA BRCA -0.117; TCGA COAD -0.253; TCGA ESCA -0.222; TCGA HNSC -0.161; TCGA KIRC -0.175; TCGA LIHC -0.137; TCGA THCA -0.648; TCGA STAD -0.311 |
hsa-miR-486-5p | FHL3 | 9 cancers: BLCA; CESC; COAD; KIRP; LIHC; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.089; TCGA CESC -0.067; TCGA COAD -0.1; TCGA KIRP -0.089; TCGA LIHC -0.137; TCGA LUSC -0.059; TCGA THCA -0.174; TCGA STAD -0.132; TCGA UCEC -0.08 |
hsa-miR-486-5p | CLIP3 | 9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; SARC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.181; TCGA COAD -0.226; TCGA ESCA -0.15; TCGA HNSC -0.138; TCGA LIHC -0.079; TCGA SARC -0.212; TCGA THCA -0.281; TCGA STAD -0.213; TCGA UCEC -0.27 |
hsa-miR-486-5p | NRK | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.265; TCGA BRCA -0.08; TCGA CESC -0.188; TCGA COAD -0.432; TCGA ESCA -0.459; TCGA KIRC -0.519; TCGA LUAD -0.147; TCGA STAD -0.645; TCGA UCEC -0.225 |
hsa-miR-486-5p | LYPD1 | 9 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA | PITA; miRanda | TCGA BRCA -0.173; TCGA HNSC -0.163; TCGA KIRP -0.117; TCGA LGG -0.059; TCGA LIHC -0.442; TCGA LUAD -0.182; TCGA LUSC -0.303; TCGA PAAD -0.263; TCGA THCA -0.296 |
hsa-miR-486-5p | CLK2 | 10 cancers: BRCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; THCA; STAD | miRanda | TCGA BRCA -0.073; TCGA ESCA -0.052; TCGA HNSC -0.078; TCGA KIRP -0.068; TCGA LIHC -0.123; TCGA LUAD -0.104; TCGA LUSC -0.114; TCGA OV -0.081; TCGA THCA -0.053; TCGA STAD -0.051 |
hsa-miR-486-5p | GAD1 | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; STAD | miRanda | TCGA BRCA -0.25; TCGA CESC -0.178; TCGA ESCA -0.299; TCGA HNSC -0.289; TCGA KIRC -0.296; TCGA LIHC -0.244; TCGA LUAD -0.31; TCGA LUSC -0.442; TCGA STAD -0.358 |
hsa-miR-486-5p | CNKSR1 | 9 cancers: BRCA; CESC; KIRC; KIRP; LGG; LUAD; OV; PAAD; THCA | miRanda | TCGA BRCA -0.216; TCGA CESC -0.06; TCGA KIRC -0.439; TCGA KIRP -0.212; TCGA LGG -0.104; TCGA LUAD -0.085; TCGA OV -0.086; TCGA PAAD -0.202; TCGA THCA -0.099 |
hsa-miR-486-5p | PLXNB3 | 10 cancers: BRCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD | miRanda | TCGA BRCA -0.059; TCGA HNSC -0.109; TCGA KIRP -0.137; TCGA LGG -0.056; TCGA LIHC -0.274; TCGA LUAD -0.268; TCGA LUSC -0.41; TCGA PRAD -0.108; TCGA SARC -0.253; TCGA STAD -0.183 |
hsa-miR-486-5p | TCTE3 | 14 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD | miRanda | TCGA BRCA -0.072; TCGA CESC -0.06; TCGA ESCA -0.126; TCGA HNSC -0.139; TCGA KIRC -0.093; TCGA KIRP -0.156; TCGA LGG -0.058; TCGA LUAD -0.103; TCGA LUSC -0.172; TCGA OV -0.142; TCGA PRAD -0.09; TCGA SARC -0.123; TCGA THCA -0.053; TCGA STAD -0.118 |
hsa-miR-486-5p | DLG5 | 9 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD | miRanda | TCGA BRCA -0.053; TCGA KIRP -0.071; TCGA LGG -0.07; TCGA LIHC -0.161; TCGA LUAD -0.113; TCGA LUSC -0.219; TCGA PAAD -0.081; TCGA SARC -0.077; TCGA STAD -0.098 |
hsa-miR-486-5p | ZGLP1 | 9 cancers: BRCA; HNSC; KIRP; LGG; LUAD; OV; THCA; STAD; UCEC | miRanda | TCGA BRCA -0.076; TCGA HNSC -0.17; TCGA KIRP -0.104; TCGA LGG -0.069; TCGA LUAD -0.082; TCGA OV -0.134; TCGA THCA -0.132; TCGA STAD -0.116; TCGA UCEC -0.079 |
hsa-miR-486-5p | DNAH14 | 9 cancers: BRCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD | miRanda | TCGA BRCA -0.248; TCGA HNSC -0.178; TCGA KIRP -0.098; TCGA LIHC -0.207; TCGA LUAD -0.192; TCGA LUSC -0.233; TCGA PRAD -0.082; TCGA THCA -0.056; TCGA STAD -0.176 |
hsa-miR-486-5p | SOX12 | 9 cancers: BRCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; THCA; STAD | miRNATAP | TCGA BRCA -0.224; TCGA HNSC -0.154; TCGA LGG -0.089; TCGA LIHC -0.166; TCGA LUAD -0.128; TCGA LUSC -0.211; TCGA OV -0.084; TCGA THCA -0.063; TCGA STAD -0.124 |
hsa-miR-486-5p | BRSK1 | 9 cancers: BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; THCA | miRNATAP | TCGA BRCA -0.162; TCGA COAD -0.1; TCGA HNSC -0.125; TCGA KIRP -0.162; TCGA LIHC -0.319; TCGA LUAD -0.243; TCGA LUSC -0.261; TCGA SARC -0.151; TCGA THCA -0.109 |
hsa-miR-486-5p | RNF207 | 10 cancers: CESC; ESCA; KIRP; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD | miRanda | TCGA CESC -0.091; TCGA ESCA -0.171; TCGA KIRP -0.146; TCGA LIHC -0.066; TCGA LUAD -0.143; TCGA LUSC -0.088; TCGA OV -0.136; TCGA PAAD -0.145; TCGA THCA -0.079; TCGA STAD -0.177 |
hsa-miR-486-5p | NUDT11 | 10 cancers: COAD; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; STAD; UCEC | miRanda | TCGA COAD -0.19; TCGA HNSC -0.214; TCGA KIRC -0.236; TCGA KIRP -0.127; TCGA LGG -0.067; TCGA LUSC -0.311; TCGA PRAD -0.197; TCGA THCA -0.219; TCGA STAD -0.168; TCGA UCEC -0.241 |
Enriched cancer pathways of putative targets