microRNA information: hsa-miR-487a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-487a-3p | miRbase |
| Accession: | MIMAT0002178 | miRbase |
| Precursor name: | hsa-mir-487a | miRbase |
| Precursor accession: | MI0002471 | miRbase |
| Symbol: | MIR487A | HGNC |
| RefSeq ID: | NR_030162 | GenBank |
| Sequence: | AAUCAUACAGGGACAUCCAGUU |
Reported expression in cancers: hsa-miR-487a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-487a-3p | kidney renal cell cancer | deregulation | "This study aims to profile dysregulated microRNA m ......" | 25938468 | Microarray |
Reported cancer pathway affected by hsa-miR-487a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-487a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-487a-3p | breast cancer | drug resistance | "MiR 487a resensitizes mitoxantrone MX resistant br ......" | 23879965 | Luciferase |
| hsa-miR-487a-3p | breast cancer | metastasis | "MiR 487a Promotes TGF β1 induced EMT the Migratio ......" | 27019625 | |
| hsa-miR-487a-3p | kidney renal cell cancer | staging | "This study aims to profile dysregulated microRNA m ......" | 25938468 |
Reported gene related to hsa-miR-487a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-487a-3p | breast cancer | ABCG2 | "In the present study bioinformatic analysis indica ......" | 23879965 |
| hsa-miR-487a-3p | breast cancer | CDH1 | "Subsequently we found that the transfection of miR ......" | 27019625 |
| hsa-miR-487a-3p | breast cancer | MAGI2 | "MiR 487a Promotes TGF β1 induced EMT the Migratio ......" | 27019625 |
| hsa-miR-487a-3p | breast cancer | MX1 | "MiR 487a resensitizes mitoxantrone MX resistant br ......" | 23879965 |
| hsa-miR-487a-3p | breast cancer | NFKB1 | "In addition the results showed that NF-kappaB p65 ......" | 27019625 |
| hsa-miR-487a-3p | breast cancer | PTEN | "Furthermore our findings demonstrated that miR-487 ......" | 27019625 |
| hsa-miR-487a-3p | breast cancer | VIM | "Subsequently we found that the transfection of miR ......" | 27019625 |