microRNA information: hsa-miR-488-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-488-5p | miRbase |
Accession: | MIMAT0002804 | miRbase |
Precursor name: | hsa-mir-488 | miRbase |
Precursor accession: | MI0003123 | miRbase |
Symbol: | MIR488 | HGNC |
RefSeq ID: | NR_030163 | GenBank |
Sequence: | CCCAGAUAAUGGCACUCUCAA |
Reported expression in cancers: hsa-miR-488-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-488-5p | gastric cancer | downregulation | "miR 488 acts as a tumor suppressor gene in gastric ......" | 26738864 |
Reported cancer pathway affected by hsa-miR-488-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-488-5p | gastric cancer | cell cycle pathway | "miR 488 acts as a tumor suppressor gene in gastric ......" | 26738864 | |
hsa-miR-488-5p | sarcoma | Apoptosis pathway | "Hypoxia inducible microRNA 488 regulates apoptosis ......" | 27376839 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-488-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-488-5p | gastric cancer | staging | "miR 488 acts as a tumor suppressor gene in gastric ......" | 26738864 | |
hsa-miR-488-5p | sarcoma | drug resistance | "Hypoxia inducible microRNA 488 regulates apoptosis ......" | 27376839 | Western blot; Luciferase |
Reported gene related to hsa-miR-488-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-488-5p | sarcoma | BCL2L11 | "Hypoxia inducible microRNA 488 regulates apoptosis ......" | 27376839 |
hsa-miR-488-5p | gastric cancer | PAX6 | "PAX6 was identified as a direct target gene of miR ......" | 26738864 |
hsa-miR-488-5p | gastric cancer | REM1 | "In addition the expression of miR-488 was also low ......" | 26738864 |