microRNA information: hsa-miR-488-5p

SectionIDlink
Mature name: hsa-miR-488-5pmiRbase
Accession: MIMAT0002804miRbase
Precursor name: hsa-mir-488 miRbase
Precursor accession: MI0003123miRbase
Symbol: MIR488HGNC
RefSeq ID: NR_030163GenBank
Sequence: CCCAGAUAAUGGCACUCUCAA



Reported expression in cancers: hsa-miR-488-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-488-5p

gastric cancerdownregulation"miR 488 acts as a tumor suppressor gene in gastric ......"26738864



Reported cancer pathway affected by hsa-miR-488-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-488-5p

gastric cancercell cycle pathway"miR 488 acts as a tumor suppressor gene in gastric ......"26738864
hsa-miR-488-5p

sarcomaApoptosis pathway"Hypoxia inducible microRNA 488 regulates apoptosis ......"27376839Western blot; Luciferase



Reported cancer prognosis affected by hsa-miR-488-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-488-5p

gastric cancerstaging"miR 488 acts as a tumor suppressor gene in gastric ......"26738864
hsa-miR-488-5p

sarcomadrug resistance"Hypoxia inducible microRNA 488 regulates apoptosis ......"27376839Western blot; Luciferase



Reported gene related to hsa-miR-488-5p

miRNAcancergenereportingPUBMED
hsa-miR-488-5p

sarcomaBCL2L11"Hypoxia inducible microRNA 488 regulates apoptosis ......"27376839
hsa-miR-488-5p

gastric cancerPAX6"PAX6 was identified as a direct target gene of miR ......"26738864
hsa-miR-488-5p

gastric cancerREM1"In addition the expression of miR-488 was also low ......"26738864