microRNA information: hsa-miR-490-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-490-3p | miRbase |
Accession: | MIMAT0002806 | miRbase |
Precursor name: | hsa-mir-490 | miRbase |
Precursor accession: | MI0003125 | miRbase |
Symbol: | MIR490 | HGNC |
RefSeq ID: | NR_030165 | GenBank |
Sequence: | CAACCUGGAGGACUCCAUGCUG |
Reported expression in cancers: hsa-miR-490-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-490-3p | breast cancer | downregulation | "In this study we examined the expression and biolo ......" | 27506313 | |
hsa-miR-490-3p | colorectal cancer | downregulation | "MicroRNA 490 3p inhibits colorectal cancer metasta ......" | 26714817 | qPCR |
hsa-miR-490-3p | liver cancer | upregulation | "Using real-time quantitative RT-PCR we discovered ......" | 23212913 | qPCR |
hsa-miR-490-3p | lung cancer | upregulation | "Overexpression of miR-490-3P evidently inhibits ce ......" | 24440705 | |
hsa-miR-490-3p | lung cancer | upregulation | "Here we report that hsa-miR-490-3p expression is s ......" | 27683057 |
Reported cancer pathway affected by hsa-miR-490-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-490-3p | breast cancer | Apoptosis pathway | "MicroRNA 490 inhibits tumorigenesis and progressio ......" | 27524906 | Luciferase; Western blot |
hsa-miR-490-3p | colorectal cancer | Apoptosis pathway | "Epigenetic silencing of miR 490 3p promotes develo ......" | 27037061 | |
hsa-miR-490-3p | endometrial cancer | Apoptosis pathway | "MiR-490-3p has been reported to be a suppressor in ......" | 26843615 | Luciferase; Western blot |
hsa-miR-490-3p | sarcoma | Apoptosis pathway | "MicroRNA 490 3p regulates cell proliferation and a ......" | 26341146 |
Reported cancer prognosis affected by hsa-miR-490-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-490-3p | breast cancer | tumorigenesis | "miR 490 3p inhibits the growth and invasiveness in ......" | 27506313 | |
hsa-miR-490-3p | breast cancer | progression; tumorigenesis; staging | "MicroRNA 490 inhibits tumorigenesis and progressio ......" | 27524906 | Luciferase; Western blot |
hsa-miR-490-3p | colorectal cancer | tumorigenesis | "Differential expression of miRNAs in colorectal ca ......" | 22529906 | |
hsa-miR-490-3p | colorectal cancer | metastasis; cell migration; malignant trasformation; progression | "MicroRNA 490 3p inhibits colorectal cancer metasta ......" | 26714817 | Western blot; Luciferase |
hsa-miR-490-3p | colorectal cancer | tumorigenesis; metastasis; staging | "Epigenetic silencing of miR 490 3p promotes develo ......" | 27037061 | |
hsa-miR-490-3p | endometrial cancer | metastasis; progression; tumorigenesis | "MiR-490-3p has been reported to be a suppressor in ......" | 26843615 | Luciferase; Western blot |
hsa-miR-490-3p | gastric cancer | cell migration | "In this study we provide the first evidence that C ......" | 26825578 | |
hsa-miR-490-3p | kidney renal cell cancer | progression | "miR 490 5p suppresses tumour growth in renal cell ......" | 26559013 | |
hsa-miR-490-3p | liver cancer | drug resistance | "miR 490 3p modulates cell growth and epithelial to ......" | 23212913 | |
hsa-miR-490-3p | lung cancer | metastasis; progression; worse prognosis | "MicroRNA 490 regulates lung cancer metastasis by t ......" | 27683057 | |
hsa-miR-490-3p | ovarian cancer | drug resistance | "microRNA 490 3P enhances the drug resistance of hu ......" | 25297343 | Western blot |
hsa-miR-490-3p | sarcoma | progression; poor survival; worse prognosis | "miRNA expression was investigated in 49 primary EW ......" | 21960059 | |
hsa-miR-490-3p | sarcoma | progression | "MicroRNA 490 3p regulates cell proliferation and a ......" | 26341146 |
Reported gene related to hsa-miR-490-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-490-3p | bladder cancer | FOS | "MicroRNA 490 5p is a novel tumor suppressor target ......" | 26170849 |
hsa-miR-490-3p | bladder cancer | FOS | "MicroRNA 490 5p inhibits proliferation of bladder ......" | 24220339 |
hsa-miR-490-3p | ovarian cancer | ABCB1 | "The mRNA expression levels of MDR1 GST-π p < ......" | 25297343 |
hsa-miR-490-3p | liver cancer | AGO2 | "The up-regulation by miR-490-3p also required the ......" | 23212913 |
hsa-miR-490-3p | gastric cancer | CCAT1 | "In this study we provide the first evidence that C ......" | 26825578 |
hsa-miR-490-3p | lung cancer | CCND1 | "MicroRNA 490 3p inhibits proliferation of A549 lun ......" | 24440705 |
hsa-miR-490-3p | liver cancer | ERGIC3 | "miR 490 3p modulates cell growth and epithelial to ......" | 23212913 |
hsa-miR-490-3p | colorectal cancer | FRAT1 | "The frequently rearranged in advanced T-cell lymph ......" | 27037061 |
hsa-miR-490-3p | sarcoma | HMGA2 | "MicroRNA 490 3p regulates cell proliferation and a ......" | 26341146 |
hsa-miR-490-3p | gastric cancer | HNRNPA1 | "Furthermore miR-490 directly bound to the hnRNPA1 ......" | 26825578 |
hsa-miR-490-3p | liver cancer | HSPB3 | "miR 490 3p modulates cell growth and epithelial to ......" | 23212913 |
hsa-miR-490-3p | lung cancer | PCBP1 | "In situ analysis revealed that hsa-miR-490-3p targ ......" | 27683057 |
hsa-miR-490-3p | kidney renal cell cancer | PIK3CA | "miR 490 5p suppresses tumour growth in renal cell ......" | 26559013 |
hsa-miR-490-3p | lung cancer | RGN | "MicroRNA 490 regulates lung cancer metastasis by t ......" | 27683057 |
hsa-miR-490-3p | breast cancer | RHOA | "Dual-luciferase reporter assay and a xenograft mou ......" | 27524906 |
hsa-miR-490-3p | breast cancer | TNKS2 | "miR 490 3p inhibits the growth and invasiveness in ......" | 27506313 |