microRNA information: hsa-miR-490-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-490-5p | miRbase |
| Accession: | MIMAT0004764 | miRbase |
| Precursor name: | hsa-mir-490 | miRbase |
| Precursor accession: | MI0003125 | miRbase |
| Symbol: | MIR490 | HGNC |
| RefSeq ID: | NR_030165 | GenBank |
| Sequence: | CCAUGGAUCUCCAGGUGGGU |
Reported expression in cancers: hsa-miR-490-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-490-5p | bladder cancer | downregulation | "Here we found that miR-490-5p is down-regulated in ......" | 24220339 | |
| hsa-miR-490-5p | bladder cancer | downregulation | "Here we describe the regulation and function of mi ......" | 26170849 | qPCR |
| hsa-miR-490-5p | kidney renal cell cancer | downregulation | "Recent studies indicated that miR-490 is involved ......" | 26559013 |
Reported cancer pathway affected by hsa-miR-490-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-490-5p | bladder cancer | Apoptosis pathway | "MicroRNA 490 5p is a novel tumor suppressor target ......" | 26170849 | Western blot |
| hsa-miR-490-5p | sarcoma | Apoptosis pathway | "MicroRNA 490 3p regulates cell proliferation and a ......" | 26341146 |
Reported cancer prognosis affected by hsa-miR-490-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-490-5p | bladder cancer | malignant trasformation | "MicroRNA 490 5p inhibits proliferation of bladder ......" | 24220339 | Luciferase |
| hsa-miR-490-5p | bladder cancer | tumorigenesis | "MicroRNA 490 5p is a novel tumor suppressor target ......" | 26170849 | Western blot |
| hsa-miR-490-5p | breast cancer | progression; tumorigenesis | "MicroRNA 490 inhibits tumorigenesis and progressio ......" | 27524906 | |
| hsa-miR-490-5p | colorectal cancer | metastasis | "Identification of core miRNA based on small RNA se ......" | 25412953 | |
| hsa-miR-490-5p | colorectal cancer | metastasis | "MicroRNA 490 3p inhibits colorectal cancer metasta ......" | 26714817 | |
| hsa-miR-490-5p | gastric cancer | cell migration | "In this study we provide the first evidence that C ......" | 26825578 | |
| hsa-miR-490-5p | kidney renal cell cancer | progression | "miR 490 5p suppresses tumour growth in renal cell ......" | 26559013 | |
| hsa-miR-490-5p | lung cancer | metastasis | "MicroRNA 490 regulates lung cancer metastasis by t ......" | 27683057 | |
| hsa-miR-490-5p | ovarian cancer | drug resistance | "microRNA 490 3P enhances the drug resistance of hu ......" | 25297343 | Western blot |
Reported gene related to hsa-miR-490-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-490-5p | bladder cancer | FOS | "MicroRNA 490 5p is a novel tumor suppressor target ......" | 26170849 |
| hsa-miR-490-5p | bladder cancer | FOS | "MicroRNA 490 5p inhibits proliferation of bladder ......" | 24220339 |
| hsa-miR-490-5p | gastric cancer | CCAT1 | "In this study we provide the first evidence that C ......" | 26825578 |
| hsa-miR-490-5p | lung cancer | CCND1 | "MicroRNA 490 3p inhibits proliferation of A549 lun ......" | 24440705 |
| hsa-miR-490-5p | liver cancer | ERGIC3 | "miR 490 3p modulates cell growth and epithelial to ......" | 23212913 |
| hsa-miR-490-5p | sarcoma | HMGA2 | "MicroRNA 490 3p regulates cell proliferation and a ......" | 26341146 |
| hsa-miR-490-5p | gastric cancer | HNRNPA1 | "Furthermore miR-490 directly bound to the hnRNPA1 ......" | 26825578 |
| hsa-miR-490-5p | liver cancer | HSPB3 | "miR 490 3p modulates cell growth and epithelial to ......" | 23212913 |
| hsa-miR-490-5p | kidney renal cell cancer | PIK3CA | "miR 490 5p suppresses tumour growth in renal cell ......" | 26559013 |
| hsa-miR-490-5p | lung cancer | RGN | "MicroRNA 490 regulates lung cancer metastasis by t ......" | 27683057 |
| hsa-miR-490-5p | breast cancer | TNKS2 | "miR 490 3p inhibits the growth and invasiveness in ......" | 27506313 |