microRNA information: hsa-miR-491-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-491-3p | miRbase |
Accession: | MIMAT0004765 | miRbase |
Precursor name: | hsa-mir-491 | miRbase |
Precursor accession: | MI0003126 | miRbase |
Symbol: | MIR491 | HGNC |
RefSeq ID: | NR_030166 | GenBank |
Sequence: | CUUAUGCAAGAUUCCCUUCUAC |
Reported expression in cancers: hsa-miR-491-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-491-3p | esophageal cancer | downregulation | "The luciferase reporter assay was used to confirm ......" | 26279431 | |
hsa-miR-491-3p | glioblastoma | downregulation | "Two mature products of MIR 491 coordinate to suppr ......" | 24747968 | RNA-Seq |
hsa-miR-491-3p | kidney renal cell cancer | deregulation | "This study aims to profile dysregulated microRNA m ......" | 25938468 | Microarray |
hsa-miR-491-3p | liver cancer | downregulation | "MicroRNA 491 is involved in metastasis of hepatoce ......" | 23725476 | qPCR; Microarray |
Reported cancer pathway affected by hsa-miR-491-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-491-3p | colorectal cancer | Apoptosis pathway | "Functional screening identifies a microRNA miR 491 ......" | 20039318 | |
hsa-miR-491-3p | ovarian cancer | Apoptosis pathway | "miR 491 5p induced apoptosis in ovarian carcinoma ......" | 25299770 | |
hsa-miR-491-3p | pancreatic cancer | Apoptosis pathway | "MicroRNA miR 491 5p targeting both TP53 and Bcl XL ......" | 23519249 | |
hsa-miR-491-3p | thyroid cancer | cell cycle pathway | "MATERIAL AND METHODS We conducted qRT-PCR analysis ......" | 27062921 |
Reported cancer prognosis affected by hsa-miR-491-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-491-3p | glioblastoma | poor survival | "Two mature products of MIR 491 coordinate to suppr ......" | 24747968 | |
hsa-miR-491-3p | kidney renal cell cancer | staging | "This study aims to profile dysregulated microRNA m ......" | 25938468 | |
hsa-miR-491-3p | liver cancer | metastasis; differentiation | "MicroRNA 491 is involved in metastasis of hepatoce ......" | 23725476 | Western blot; Transwell assay |
hsa-miR-491-3p | liver cancer | recurrence | "MiR 491 attenuates cancer stem cells like properti ......" | 26188902 | |
hsa-miR-491-3p | liver cancer | staging; tumor size; poor survival; malignant trasformation | "miR 491 inhibits the proliferation invasion and mi ......" | 27053618 | MTT assay; Western blot |
hsa-miR-491-3p | lung squamous cell cancer | staging | "To explore the potential therapeutic targets of ea ......" | 26781349 |
Reported gene related to hsa-miR-491-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-491-3p | liver cancer | MMP9 | "Our results suggest that miR-491 is involved in me ......" | 23725476 |
hsa-miR-491-3p | liver cancer | MMP9 | "On one hand as a target miRNA of MMP9 miR-491 decr ......" | 24680928 |
hsa-miR-491-3p | esophageal cancer | TPX2 | "Low Expression of miR 491 Promotes Esophageal Canc ......" | 26279431 |
hsa-miR-491-3p | liver cancer | TPX2 | "miR 491 inhibits the proliferation invasion and mi ......" | 27053618 |
hsa-miR-491-3p | liver cancer | ADRA1A | "Overexpression of miR-491 targeted G-protein-coupl ......" | 26188902 |
hsa-miR-491-3p | colorectal cancer | BCL2L1 | "Functional screening identifies a microRNA miR 491 ......" | 20039318 |
hsa-miR-491-3p | liver cancer | CDH1 | "Moreover miR-491 had a positive relationship with ......" | 23725476 |
hsa-miR-491-3p | glioblastoma | CDKN2A | "MIR-491 is commonly co-deleted with its adjacent C ......" | 24747968 |
hsa-miR-491-3p | liver cancer | CIB1 | "Overexpression of miR-491 targeted G-protein-coupl ......" | 26188902 |
hsa-miR-491-3p | thyroid cancer | CTGF | "We identified CTGF as target of miR-491 and viabil ......" | 27062921 |
hsa-miR-491-3p | breast cancer | KDM4B | "miR 491 5p functions as a tumor suppressor by targ ......" | 25725194 |
hsa-miR-491-3p | liver cancer | P4HB | "MiR 491 attenuates cancer stem cells like properti ......" | 26188902 |
hsa-miR-491-3p | liver cancer | VIM | "Moreover miR-491 had a positive relationship with ......" | 23725476 |
Expression profile in cancer corhorts: