microRNA information: hsa-miR-494-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-494-3p | miRbase |
Accession: | MIMAT0002816 | miRbase |
Precursor name: | hsa-mir-494 | miRbase |
Precursor accession: | MI0003134 | miRbase |
Symbol: | MIR494 | HGNC |
RefSeq ID: | NR_030174 | GenBank |
Sequence: | UGAAACAUACACGGGAAACCUC |
Reported expression in cancers: hsa-miR-494-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-494-3p | breast cancer | upregulation | "In addition hsa-miR-494 and hsa-miR-21 were deregu ......" | 25277099 | |
hsa-miR-494-3p | cervical and endocervical cancer | upregulation | "However the role mechanism and clinical significan ......" | 25738254 | |
hsa-miR-494-3p | esophageal cancer | upregulation | "Upregulation of miR 494 Inhibits Cell Growth and I ......" | 25480402 | |
hsa-miR-494-3p | gastric cancer | downregulation | "We recently showed that miR-494 was downregulated ......" | 24612089 | |
hsa-miR-494-3p | liver cancer | upregulation | "MicroRNA 494 is a master epigenetic regulator of m ......" | 25820676 | |
hsa-miR-494-3p | liver cancer | upregulation | "MicroRNA-494 miR-494 acts as an oncomiR and is inv ......" | 26045065 | qPCR |
hsa-miR-494-3p | lung squamous cell cancer | downregulation | "miR-494 was the most down-regulated microRNA after ......" | 23012423 | |
hsa-miR-494-3p | lymphoma | deregulation | "In addition we derived an 11-miRNA signature 4 upr ......" | 23801630 | |
hsa-miR-494-3p | ovarian cancer | upregulation | "The aim of the present study was to investigate th ......" | 27313773 | qPCR |
hsa-miR-494-3p | pancreatic cancer | downregulation | "Correlation of miR 494 expression with tumor progr ......" | 26782462 | |
hsa-miR-494-3p | retinoblastoma | upregulation | "Identification of miRNAs associated with tumorigen ......" | 18818933 | Microarray; Northern blot; in situ hybridization |
hsa-miR-494-3p | sarcoma | downregulation | "Here using comparative miRNA profiling of tissues ......" | 26317788 |
Reported cancer pathway affected by hsa-miR-494-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-494-3p | acute myeloid leukemia | Apoptosis pathway | "MicroRNA 494 Activation Suppresses Bone Marrow Str ......" | 27696394 | |
hsa-miR-494-3p | colon cancer | Apoptosis pathway | "MicroRNA 494 sensitizes colon cancer cells to fluo ......" | 25873402 | |
hsa-miR-494-3p | colorectal cancer | cell cycle pathway | "MicroRNA 494 within an oncogenic microRNA megaclus ......" | 23913442 | |
hsa-miR-494-3p | esophageal cancer | Apoptosis pathway | "Upregulation of miR 494 Inhibits Cell Growth and I ......" | 25480402 | Colony formation; Cell migration assay; Western blot; Luciferase |
hsa-miR-494-3p | gastric cancer | Apoptosis pathway | "Cinobufacin suppresses cell proliferation via miR ......" | 24606447 | Flow cytometry; Western blot; Luciferase |
hsa-miR-494-3p | glioblastoma | PI3K/Akt signaling pathway; Apoptosis pathway | "miR 494 3p Regulates Cellular Proliferation Invasi ......" | 25662849 | Western blot |
hsa-miR-494-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "miR 494 promotes cell proliferation migration and ......" | 26045065 | Luciferase |
hsa-miR-494-3p | lung squamous cell cancer | Apoptosis pathway | "MiR 494 is regulated by ERK1/2 and modulates TRAIL ......" | 23012423 | |
hsa-miR-494-3p | lung squamous cell cancer | Apoptosis pathway | "Overexpression of secretagogin inhibits cell apopt ......" | 25226615 | Luciferase |
hsa-miR-494-3p | ovarian cancer | Apoptosis pathway | "miR 494 inhibits ovarian cancer cell proliferation ......" | 27313773 | Flow cytometry; Luciferase; Western blot |
hsa-miR-494-3p | pancreatic cancer | Apoptosis pathway | "Ectopic expression of miR 494 inhibited the prolif ......" | 25965392 | Luciferase; RNAi |
hsa-miR-494-3p | prostate cancer | Apoptosis pathway | "MicroRNA 494 3p targets CXCR4 to suppress the prol ......" | 24644030 | Flow cytometry |
Reported cancer prognosis affected by hsa-miR-494-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-494-3p | acute myeloid leukemia | drug resistance; poor survival | "MicroRNA 494 Activation Suppresses Bone Marrow Str ......" | 27696394 | |
hsa-miR-494-3p | breast cancer | worse prognosis | "In addition hsa-miR-494 and hsa-miR-21 were deregu ......" | 25277099 | |
hsa-miR-494-3p | breast cancer | progression; malignant trasformation | "miR 494 suppresses the progression of breast cance ......" | 25955111 | Transwell assay; Luciferase |
hsa-miR-494-3p | cervical and endocervical cancer | progression; worse prognosis; poor survival; tumorigenesis | "MicroRNA 494 promotes cervical cancer proliferatio ......" | 25738254 | |
hsa-miR-494-3p | cervical and endocervical cancer | metastasis | "Here we reported significantly higher levels of Pt ......" | 25877755 | |
hsa-miR-494-3p | colorectal cancer | tumorigenesis; tumor size | "MicroRNA 494 within an oncogenic microRNA megaclus ......" | 23913442 | |
hsa-miR-494-3p | colorectal cancer | poor survival | "In this study ten candidates were identified using ......" | 27126129 | |
hsa-miR-494-3p | esophageal cancer | metastasis | "Upregulation of miR 494 Inhibits Cell Growth and I ......" | 25480402 | Colony formation; Cell migration assay; Western blot; Luciferase |
hsa-miR-494-3p | gastric cancer | worse prognosis | "miR 494 acts as an anti oncogene in gastric carcin ......" | 24612089 | RNA Immunoprecipitation; Luciferase; RNA immunoprecipitation; Colony formation |
hsa-miR-494-3p | glioblastoma | malignant trasformation | "miR 494 3p Regulates Cellular Proliferation Invasi ......" | 25662849 | Western blot |
hsa-miR-494-3p | liver cancer | drug resistance; metastasis; progression; staging; differentiation | "miR 494 promotes cell proliferation migration and ......" | 26045065 | Luciferase |
hsa-miR-494-3p | lung squamous cell cancer | drug resistance | "MiR 494 is regulated by ERK1/2 and modulates TRAIL ......" | 23012423 | |
hsa-miR-494-3p | lung squamous cell cancer | drug resistance | "Overexpression of secretagogin inhibits cell apopt ......" | 25226615 | Luciferase |
hsa-miR-494-3p | lung squamous cell cancer | worse prognosis; staging; metastasis; differentiation; poor survival | "Expression and clinical evidence of miR 494 and PT ......" | 25861022 | |
hsa-miR-494-3p | lung squamous cell cancer | drug resistance | "Tumor derived microRNA 494 promotes angiogenesis i ......" | 26040900 | |
hsa-miR-494-3p | lymphoma | drug resistance | "Microarray profiling of more than 1000 human miRNA ......" | 24222179 | |
hsa-miR-494-3p | pancreatic cancer | drug resistance; staging; metastasis; worse prognosis; tumor size | "Ectopic expression of miR 494 inhibited the prolif ......" | 25965392 | Luciferase; RNAi |
hsa-miR-494-3p | pancreatic cancer | progression; poor survival; staging; metastasis | "Correlation of miR 494 expression with tumor progr ......" | 26782462 | |
hsa-miR-494-3p | prostate cancer | metastasis; progression | "MicroRNA 494 3p targets CXCR4 to suppress the prol ......" | 24644030 | Flow cytometry |
hsa-miR-494-3p | retinoblastoma | tumorigenesis | "Identification of miRNAs associated with tumorigen ......" | 18818933 | |
hsa-miR-494-3p | sarcoma | differentiation; worse prognosis; poor survival | "MicroRNA 494 inhibits cell proliferation and invas ......" | 26317788 | |
hsa-miR-494-3p | sarcoma | metastasis | "MicroRNA 494 inhibits proliferation and metastasis ......" | 27648134 | Colony formation |
Reported gene related to hsa-miR-494-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-494-3p | cervical and endocervical cancer | PTEN | "MicroRNA 494 promotes cervical cancer proliferatio ......" | 25738254 |
hsa-miR-494-3p | glioblastoma | PTEN | "Quantitative reverse transcription PCR and Western ......" | 25662849 |
hsa-miR-494-3p | liver cancer | PTEN | "miR 494 promotes cell proliferation migration and ......" | 26045065 |
hsa-miR-494-3p | lung squamous cell cancer | PTEN | "Expression and clinical evidence of miR 494 and PT ......" | 25861022 |
hsa-miR-494-3p | lung squamous cell cancer | PTEN | "The angiogenic effect of miR-494 was mediated by t ......" | 26040900 |
hsa-miR-494-3p | acute myeloid leukemia | MYC | "Reporter gene analysis confirmed miR-494 as one of ......" | 27696394 |
hsa-miR-494-3p | gastric cancer | MYC | "miR 494 acts as an anti oncogene in gastric carcin ......" | 24612089 |
hsa-miR-494-3p | ovarian cancer | MYC | "MiR 494 Inhibits Epithelial Ovarian Cancer Growth ......" | 26908019 |
hsa-miR-494-3p | pancreatic cancer | MYC | "Meanwhile both c-Myc and SIRT1 was identified as t ......" | 25965392 |
hsa-miR-494-3p | breast cancer | CXCR4 | "miR 494 suppresses the progression of breast cance ......" | 25955111 |
hsa-miR-494-3p | prostate cancer | CXCR4 | "MicroRNA 494 3p targets CXCR4 to suppress the prol ......" | 24644030 |
hsa-miR-494-3p | head and neck cancer | ADAM10 | "Activation of microRNA 494 targeting Bmi1 and ADAM ......" | 26090866 |
hsa-miR-494-3p | gastric cancer | AGO2 | "Additionally c-myc and miR-494 were enriched in co ......" | 24612089 |
hsa-miR-494-3p | gastric cancer | BAG1 | "Further study verified BAG-1 anti-apoptosis gene t ......" | 24606447 |
hsa-miR-494-3p | lung squamous cell cancer | BCL2L11 | "MiR 494 is regulated by ERK1/2 and modulates TRAIL ......" | 23012423 |
hsa-miR-494-3p | head and neck cancer | BMI1 | "Activation of microRNA 494 targeting Bmi1 and ADAM ......" | 26090866 |
hsa-miR-494-3p | lymphoma | CHRDL1 | "Microarray profiling of more than 1000 human miRNA ......" | 24222179 |
hsa-miR-494-3p | esophageal cancer | CLPTM1L | "Using bioinformatics analyses we found that cleft ......" | 25480402 |
hsa-miR-494-3p | colon cancer | DPYD | "MicroRNA 494 sensitizes colon cancer cells to fluo ......" | 25873402 |
hsa-miR-494-3p | ovarian cancer | FGFR2 | "miR 494 inhibits ovarian cancer cell proliferation ......" | 27313773 |
hsa-miR-494-3p | gastric cancer | IGF1R | "Then luciferase reporter assay was used to elucida ......" | 27735036 |
hsa-miR-494-3p | lung cancer | IGF2 | "Therefore we analysed IGF2 mRNA levels and reveale ......" | 22151897 |
hsa-miR-494-3p | lung cancer | IGF2BP1 | "Next we sought to investigate insulin-like growth ......" | 22151897 |
hsa-miR-494-3p | sarcoma | INSR | "MicroRNA 494 inhibits proliferation and metastasis ......" | 27648134 |
hsa-miR-494-3p | sarcoma | IRS1 | "Further integrative and functional studies suggest ......" | 27648134 |
hsa-miR-494-3p | head and neck cancer | MMP8 | "We conclude that the inhibition of tumor aggressiv ......" | 26090866 |
hsa-miR-494-3p | cervical and endocervical cancer | PTTG1 | "Here we reported significantly higher levels of Pt ......" | 25877755 |
hsa-miR-494-3p | lung squamous cell cancer | SCGN | "Overexpression of secretagogin inhibits cell apopt ......" | 25226615 |
hsa-miR-494-3p | pancreatic cancer | SIRT1 | "Meanwhile both c-Myc and SIRT1 was identified as t ......" | 25965392 |
hsa-miR-494-3p | sarcoma | SOX9 | "MicroRNA 494 inhibits cell proliferation and invas ......" | 26317788 |
hsa-miR-494-3p | liver cancer | TET1 | "Our results show that ten eleven translocation TET ......" | 25820676 |
hsa-miR-494-3p | lung squamous cell cancer | TNS1 | "The aim of this study was to explore the expressio ......" | 25861022 |
Expression profile in cancer corhorts: