microRNA information: hsa-miR-497-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-497-5p | miRbase |
| Accession: | MIMAT0002820 | miRbase |
| Precursor name: | hsa-mir-497 | miRbase |
| Precursor accession: | MI0003138 | miRbase |
| Symbol: | MIR497 | HGNC |
| RefSeq ID: | NR_030178 | GenBank |
| Sequence: | CAGCAGCACACUGUGGUUUGU |
Reported expression in cancers: hsa-miR-497-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-497-5p | B cell lymphoma | upregulation | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
| hsa-miR-497-5p | breast cancer | deregulation | "For identification of differentially expressed mic ......" | 20331864 | qPCR |
| hsa-miR-497-5p | breast cancer | downregulation | "Analysis of MiR 195 and MiR 497 expression regulat ......" | 21350001 | Northern blot; qPCR; RNA-Seq |
| hsa-miR-497-5p | breast cancer | upregulation | "The purpose of this study was to investigate the e ......" | 22969914 | Reverse transcription PCR |
| hsa-miR-497-5p | breast cancer | upregulation | "Quantitative polymerase chain reaction was used to ......" | 24112607 | qPCR |
| hsa-miR-497-5p | breast cancer | downregulation | "Expression of microRNA 497 and its prognostic sign ......" | 24143964 | qPCR |
| hsa-miR-497-5p | breast cancer | downregulation | "miR 497 suppresses angiogenesis in breast carcinom ......" | 26718330 | |
| hsa-miR-497-5p | breast cancer | upregulation | "Furthermore upregulated miR-497 expression by mimi ......" | 27303812 | |
| hsa-miR-497-5p | cervical and endocervical cancer | downregulation | "MicroRNA 497 is a potential prognostic marker in h ......" | 23453369 | |
| hsa-miR-497-5p | colorectal cancer | downregulation | "MicroRNA 497 targets insulin like growth factor 1 ......" | 22710713 | |
| hsa-miR-497-5p | gastric cancer | upregulation | "The most highly expressed miRNAs in non-tumorous t ......" | 19175831 | |
| hsa-miR-497-5p | gastric cancer | downregulation | "Aberrant expression of miR-497 has been frequently ......" | 24845562 | |
| hsa-miR-497-5p | glioblastoma | downregulation | "Serum and tissues miRNAs expression in patients wi ......" | 27476114 | qPCR |
| hsa-miR-497-5p | liver cancer | downregulation | "The tumor suppressive miR 497 195 cluster targets ......" | 23544130 | RNA-Seq |
| hsa-miR-497-5p | liver cancer | downregulation | "MicroRNAs miRNAs have been shown to play important ......" | 26336827 | |
| hsa-miR-497-5p | liver cancer | downregulation | "MicroRNA 497 regulates cell proliferation in hepat ......" | 26893696 | |
| hsa-miR-497-5p | lung squamous cell cancer | downregulation | "Here we showed that miR-497 is downregulated in NS ......" | 23673296 | |
| hsa-miR-497-5p | lung squamous cell cancer | deregulation | "To investigate the expression clinical significanc ......" | 26316081 | qPCR |
| hsa-miR-497-5p | lung squamous cell cancer | upregulation | "Overexpression of miR-497 in NSCLC lines inhibited ......" | 26485685 | |
| hsa-miR-497-5p | ovarian cancer | downregulation | "Previously we observed frequent down-regulation of ......" | 24858688 | |
| hsa-miR-497-5p | ovarian cancer | downregulation | "MicroRNA 497 suppresses angiogenesis by targeting ......" | 25176450 | |
| hsa-miR-497-5p | pancreatic cancer | downregulation | "Insulin like growth factor 1 receptor IGF 1R as a ......" | 24667580 | |
| hsa-miR-497-5p | pancreatic cancer | downregulation | "MiR 497 downregulation contributes to the malignan ......" | 25149530 | |
| hsa-miR-497-5p | prostate cancer | downregulation | "Recently miRNAprofiling studies demonstrated the m ......" | 23886135 | |
| hsa-miR-497-5p | prostate cancer | downregulation | "MicroRNA 497 targets hepatoma derived growth facto ......" | 26780929 |
Reported cancer pathway affected by hsa-miR-497-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-497-5p | B cell lymphoma | Apoptosis pathway | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
| hsa-miR-497-5p | breast cancer | Apoptosis pathway; cell cycle pathway | "miR 497 induces apoptosis of breast cancer cells b ......" | 22969914 | Western blot |
| hsa-miR-497-5p | breast cancer | cell cycle pathway | "The purpose of this study was to examine the expre ......" | 24112607 | Colony formation; MTT assay; Transwell assay; Wound Healing Assay; Western blot; Luciferase |
| hsa-miR-497-5p | breast cancer | Apoptosis pathway | "MicroRNA 497 induces cell apoptosis by negatively ......" | 26339338 | Flow cytometry; Colony formation; MTT assay; Luciferase; Western blot |
| hsa-miR-497-5p | breast cancer | Epithelial mesenchymal transition pathway; Apoptosis pathway | "miR 497 inhibits epithelial mesenchymal transition ......" | 26700673 | Luciferase |
| hsa-miR-497-5p | cervical and endocervical cancer | Apoptosis pathway | "MicroRNA 497 is a potential prognostic marker in h ......" | 23453369 | Colony formation |
| hsa-miR-497-5p | liver cancer | cell cycle pathway | "The tumor suppressive miR 497 195 cluster targets ......" | 23544130 | |
| hsa-miR-497-5p | ovarian cancer | Apoptosis pathway | "Overexpression of microRNA 497 suppresses cell pro ......" | 27513319 | Transwell assay; Flow cytometry; Luciferase; RNAi |
| hsa-miR-497-5p | pancreatic cancer | Apoptosis pathway | "Insulin like growth factor 1 receptor IGF 1R as a ......" | 24667580 | |
| hsa-miR-497-5p | prostate cancer | Apoptosis pathway; cell cycle pathway | "MicroRNA 497 suppresses proliferation and induces ......" | 23886135 | |
| hsa-miR-497-5p | prostate cancer | cell cycle pathway | "Tumor suppressive microRNA 497 targets IKKβ to re ......" | 26175947 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-miR-497-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "MicroRNA 497 suppresses osteosarcoma tumor growth ......" | 26998150 | Colony formation |
Reported cancer prognosis affected by hsa-miR-497-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-497-5p | B cell lymphoma | poor survival | "miR 199a and miR 497 Are Associated with Better Ov ......" | 26251897 | |
| hsa-miR-497-5p | bladder cancer | metastasis; progression | "The microRNA expression signature of bladder cance ......" | 24520312 | Western blot; Luciferase |
| hsa-miR-497-5p | breast cancer | poor survival | "To investigate the global expression profile of mi ......" | 18812439 | |
| hsa-miR-497-5p | breast cancer | staging; metastasis; tumor size | "miR 497 induces apoptosis of breast cancer cells b ......" | 22969914 | Western blot |
| hsa-miR-497-5p | breast cancer | malignant trasformation | "In support of these findings in vitro functional s ......" | 24104550 | |
| hsa-miR-497-5p | breast cancer | staging; metastasis; differentiation; poor survival; progression; worse prognosis | "Expression of microRNA 497 and its prognostic sign ......" | 24143964 | |
| hsa-miR-497-5p | breast cancer | tumorigenesis | "Microarray technology was used to evaluate miRNA p ......" | 25393370 | |
| hsa-miR-497-5p | breast cancer | poor survival; drug resistance; worse prognosis | "microRNA 497 Modulates Breast Cancer Cell Prolifer ......" | 27303812 | Flow cytometry |
| hsa-miR-497-5p | cervical and endocervical cancer | malignant trasformation; poor survival; staging; metastasis | "MicroRNA 497 is a potential prognostic marker in h ......" | 23453369 | Colony formation |
| hsa-miR-497-5p | cervical and endocervical cancer | tumorigenesis | "Serum miRNAs panel miR 16 2* miR 195 miR 2861 miR ......" | 26656154 | |
| hsa-miR-497-5p | colorectal cancer | poor survival | "MicroRNA 497 targets insulin like growth factor 1 ......" | 22710713 | |
| hsa-miR-497-5p | colorectal cancer | metastasis; cell migration; motility | "MicroRNA 497 and bufalin act synergistically to in ......" | 24375248 | Cell migration assay |
| hsa-miR-497-5p | colorectal cancer | metastasis; cell migration | "MiR 497 promotes metastasis of colorectal cancer c ......" | 25926384 | Cell migration assay |
| hsa-miR-497-5p | colorectal cancer | metastasis | "microRNA 497 inhibits invasion and metastasis of c ......" | 26840372 | |
| hsa-miR-497-5p | gastric cancer | progression; metastasis | "The putative tumor suppressor microRNA 497 modulat ......" | 24845562 | Western blot; Luciferase |
| hsa-miR-497-5p | glioblastoma | staging | "Serum and tissues miRNAs expression in patients wi ......" | 27476114 | |
| hsa-miR-497-5p | head and neck cancer | poor survival | "In this study we analyzed miRNA-seq data obtained ......" | 27109697 | |
| hsa-miR-497-5p | kidney renal cell cancer | worse prognosis | "We found that elevated expression of miR-21 miR-12 ......" | 26416448 | |
| hsa-miR-497-5p | liver cancer | progression; tumorigenesis | "The tumor suppressive miR 497 195 cluster targets ......" | 23544130 | |
| hsa-miR-497-5p | liver cancer | metastasis | "MiR 497 suppresses angiogenesis and metastasis of ......" | 26336827 | |
| hsa-miR-497-5p | lung squamous cell cancer | staging; poor survival | "MiR 497 Suppresses YAP1 and Inhibits Tumor Growth ......" | 26316081 | Luciferase; Colony formation |
| hsa-miR-497-5p | ovarian cancer | cell migration; metastasis; poor survival | "MicroRNA 497 inhibition of ovarian cancer cell mig ......" | 24858688 | |
| hsa-miR-497-5p | ovarian cancer | drug resistance | "MiR 497 decreases cisplatin resistance in ovarian ......" | 26238185 | |
| hsa-miR-497-5p | ovarian cancer | cell migration | "Overexpression of microRNA 497 suppresses cell pro ......" | 27513319 | Transwell assay; Flow cytometry; Luciferase; RNAi |
| hsa-miR-497-5p | pancreatic cancer | staging | "Insulin like growth factor 1 receptor IGF 1R as a ......" | 24667580 | |
| hsa-miR-497-5p | pancreatic cancer | worse prognosis | "MiR 497 downregulation contributes to the malignan ......" | 25149530 | |
| hsa-miR-497-5p | prostate cancer | metastasis | "Tumor suppressive microRNA 497 targets IKKβ to re ......" | 26175947 | Cell proliferation assay; Cell Proliferation Assay |
| hsa-miR-497-5p | prostate cancer | motility | "MicroRNA 497 targets hepatoma derived growth facto ......" | 26780929 | Western blot; Luciferase |
| hsa-miR-497-5p | sarcoma | differentiation | "In order to investigate the involvement of miRNAs ......" | 23133552 | |
| hsa-miR-497-5p | sarcoma | drug resistance; poor survival | "The Down Regulation of MicroRNA 497 Contributes to ......" | 26202364 | Western blot; Luciferase |
| hsa-miR-497-5p | sarcoma | metastasis; progression; poor survival | "MicroRNA 497 suppresses osteosarcoma tumor growth ......" | 26998150 | Colony formation |
Reported gene related to hsa-miR-497-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-497-5p | breast cancer | VEGFA | "Furthermore western blot assay confirmed that the ......" | 26718330 |
| hsa-miR-497-5p | colorectal cancer | VEGFA | "Vascular endothelial growth factor-A VEGF-A was co ......" | 26840372 |
| hsa-miR-497-5p | liver cancer | VEGFA | "MiR 497 suppresses angiogenesis and metastasis of ......" | 26336827 |
| hsa-miR-497-5p | lung squamous cell cancer | VEGFA | "Role of miR 497 in VEGF A mediated cancer cell gro ......" | 26485685 |
| hsa-miR-497-5p | ovarian cancer | VEGFA | "We further disclosed that miR-497 exerted its func ......" | 25176450 |
| hsa-miR-497-5p | pancreatic cancer | VEGFA | "Subsequent investigations disclosed that Twist was ......" | 27015364 |
| hsa-miR-497-5p | sarcoma | VEGFA | "The effects of ectopic miR-497 expression on the e ......" | 26202364 |
| hsa-miR-497-5p | breast cancer | CCNE1 | "Western blot assays confirmed that overexpression ......" | 24112607 |
| hsa-miR-497-5p | cervical and endocervical cancer | CCNE1 | "miR 497 suppresses proliferation of human cervical ......" | 24909281 |
| hsa-miR-497-5p | lung cancer | CCNE1 | "The effect of simultaneous overexpression of miR-4 ......" | 25909221 |
| hsa-miR-497-5p | breast cancer | PCNA | "Western blot assays confirmed that overexpression ......" | 24112607 |
| hsa-miR-497-5p | cervical and endocervical cancer | PCNA | "miR 497 suppresses proliferation of human cervical ......" | 24909281 |
| hsa-miR-497-5p | lung cancer | PCNA | "The effect of simultaneous overexpression of miR-4 ......" | 25909221 |
| hsa-miR-497-5p | breast cancer | BCL2 | "MicroRNA 497 induces cell apoptosis by negatively ......" | 26339338 |
| hsa-miR-497-5p | breast cancer | BCL2L2 | "miR 497 induces apoptosis of breast cancer cells b ......" | 22969914 |
| hsa-miR-497-5p | prostate cancer | CASP3 | "Taken together our results demonstrated that miR-4 ......" | 23886135 |
| hsa-miR-497-5p | breast cancer | CCND1 | "Raf-1 and Ccnd1 were identified as novel direct ta ......" | 21350001 |
| hsa-miR-497-5p | liver cancer | CHEK1 | "Checkpoint kinase 1 is negatively regulated by miR ......" | 24464213 |
| hsa-miR-497-5p | lung squamous cell cancer | DCLRE1C | "Furthermore tumor samples from NSCLC patients show ......" | 23673296 |
| hsa-miR-497-5p | breast cancer | EGF | "RT-PCR and Western blot analysis were employed to ......" | 22969914 |
| hsa-miR-497-5p | gastric cancer | EIF4E | "The putative tumor suppressor microRNA 497 modulat ......" | 24845562 |
| hsa-miR-497-5p | breast cancer | ERBB2 | "Finally high expression of miR-497 conferred a bet ......" | 27303812 |
| hsa-miR-497-5p | breast cancer | ESR1 | "MicroRNA 497 downregulation contributes to cell pr ......" | 27456360 |
| hsa-miR-497-5p | breast cancer | ESRRA | "Here we found a negative correlation between miR-4 ......" | 27456360 |
| hsa-miR-497-5p | lung squamous cell cancer | F2 | "Low miR-497 levels in tumor tissue correlated with ......" | 26316081 |
| hsa-miR-497-5p | lung squamous cell cancer | HDGF | "Downregulation of miR 497 promotes tumor growth an ......" | 23673296 |
| hsa-miR-497-5p | breast cancer | MIF | "Further overexpression of miR-497 not only inhibit ......" | 27456360 |
| hsa-miR-497-5p | colorectal cancer | MMP7 | "Moreover we detected a strong positive correlation ......" | 25926384 |
| hsa-miR-497-5p | breast cancer | MMP9 | "Further overexpression of miR-497 not only inhibit ......" | 27456360 |
| hsa-miR-497-5p | liver cancer | MTDH | "MiR 497 suppresses angiogenesis and metastasis of ......" | 26336827 |
| hsa-miR-497-5p | prostate cancer | NFASC | "Tumor suppressive microRNA 497 targets IKKβ to re ......" | 26175947 |
| hsa-miR-497-5p | ovarian cancer | PAX2 | "Overexpression of microRNA 497 suppresses cell pro ......" | 27513319 |
| hsa-miR-497-5p | breast cancer | RAF1 | "Raf-1 and Ccnd1 were identified as novel direct ta ......" | 21350001 |
| hsa-miR-497-5p | breast cancer | RASSF1 | "Male miR-152 and miR-497 upregulation and RASSF1A ......" | 25393370 |
| hsa-miR-497-5p | breast cancer | RASSF5 | "Male miR-152 and miR-497 upregulation and RASSF1A ......" | 25393370 |
| hsa-miR-497-5p | colorectal cancer | RNF41 | "MiR 497 promotes metastasis of colorectal cancer c ......" | 25926384 |
| hsa-miR-497-5p | breast cancer | SMAD7 | "microRNA 497 Modulates Breast Cancer Cell Prolifer ......" | 27303812 |
| hsa-miR-497-5p | ovarian cancer | SMURF1 | "Mechanistic investigations confirmed pro-metastati ......" | 24858688 |
| hsa-miR-497-5p | breast cancer | SNAI2 | "miR 497 inhibits epithelial mesenchymal transition ......" | 26700673 |
| hsa-miR-497-5p | pancreatic cancer | TWIST1 | "Subsequent investigations disclosed that Twist was ......" | 27015364 |
| hsa-miR-497-5p | ovarian cancer | UBE2K | "MicroRNA 497 inhibition of ovarian cancer cell mig ......" | 24858688 |
| hsa-miR-497-5p | lung squamous cell cancer | YAP1 | "MiR 497 Suppresses YAP1 and Inhibits Tumor Growth ......" | 26316081 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-497-5p | MAP2K1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.099; TCGA CESC -0.157; TCGA COAD -0.154; TCGA ESCA -0.227; TCGA HNSC -0.074; TCGA LUAD -0.147; TCGA LUSC -0.068; TCGA STAD -0.181; TCGA UCEC -0.105 |
hsa-miR-497-5p | TCEA1 | 11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.082; TCGA COAD -0.159; TCGA ESCA -0.18; TCGA HNSC -0.072; TCGA LIHC -0.054; TCGA LUAD -0.176; TCGA LUSC -0.144; TCGA OV -0.106; TCGA PAAD -0.104; TCGA STAD -0.223; TCGA UCEC -0.069 |
hsa-miR-497-5p | ATP5G3 | 9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; PAAD; UCEC | MirTarget | TCGA BLCA -0.115; TCGA BRCA -0.072; TCGA CESC -0.071; TCGA COAD -0.212; TCGA KIRC -0.123; TCGA LUAD -0.225; TCGA LUSC -0.259; TCGA PAAD -0.152; TCGA UCEC -0.124 |
hsa-miR-497-5p | GOLT1B | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.086; TCGA BRCA -0.094; TCGA CESC -0.104; TCGA COAD -0.214; TCGA ESCA -0.155; TCGA HNSC -0.131; TCGA KIRP -0.051; TCGA LIHC -0.129; TCGA LUAD -0.349; TCGA LUSC -0.219; TCGA OV -0.177; TCGA PAAD -0.124; TCGA PRAD -0.153; TCGA SARC -0.057; TCGA STAD -0.235; TCGA UCEC -0.151 |
hsa-miR-497-5p | EGLN1 | 9 cancers: BLCA; CESC; COAD; LGG; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.081; TCGA CESC -0.104; TCGA COAD -0.079; TCGA LGG -0.051; TCGA LUAD -0.148; TCGA LUSC -0.161; TCGA PRAD -0.087; TCGA STAD -0.151; TCGA UCEC -0.08 |
hsa-miR-497-5p | ENTPD7 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; OV; PRAD; SARC | MirTarget | TCGA BLCA -0.104; TCGA BRCA -0.16; TCGA CESC -0.11; TCGA HNSC -0.221; TCGA KIRP -0.076; TCGA LUAD -0.197; TCGA LUSC -0.272; TCGA OV -0.109; TCGA PRAD -0.184; TCGA SARC -0.16 |
hsa-miR-497-5p | RAB10 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.129; TCGA BRCA -0.07; TCGA CESC -0.104; TCGA COAD -0.124; TCGA ESCA -0.168; TCGA HNSC -0.12; TCGA LIHC -0.092; TCGA LUAD -0.245; TCGA LUSC -0.206; TCGA SARC -0.053; TCGA STAD -0.136; TCGA UCEC -0.109 |
hsa-miR-497-5p | PAFAH1B2 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.136; TCGA CESC -0.136; TCGA COAD -0.116; TCGA ESCA -0.194; TCGA HNSC -0.175; TCGA KIRC -0.182; TCGA LUAD -0.221; TCGA PRAD -0.201; TCGA THCA -0.09; TCGA STAD -0.137; TCGA UCEC -0.085 |
hsa-miR-497-5p | IPO7 | 11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.148; TCGA CESC -0.124; TCGA COAD -0.108; TCGA ESCA -0.126; TCGA KIRC -0.101; TCGA LIHC -0.101; TCGA LUAD -0.193; TCGA LUSC -0.101; TCGA PRAD -0.14; TCGA THCA -0.148; TCGA STAD -0.21 |
hsa-miR-497-5p | GNAI3 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.113; TCGA COAD -0.09; TCGA ESCA -0.142; TCGA HNSC -0.131; TCGA LUAD -0.133; TCGA LUSC -0.099; TCGA PRAD -0.072; TCGA STAD -0.151; TCGA UCEC -0.084 |
hsa-miR-497-5p | EIF2B2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; UCEC | MirTarget | TCGA BLCA -0.066; TCGA BRCA -0.065; TCGA CESC -0.1; TCGA COAD -0.154; TCGA ESCA -0.202; TCGA HNSC -0.167; TCGA LUAD -0.121; TCGA LUSC -0.126; TCGA OV -0.059; TCGA PAAD -0.134; TCGA UCEC -0.058 |
hsa-miR-497-5p | BZW1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.135; TCGA BRCA -0.104; TCGA CESC -0.192; TCGA COAD -0.102; TCGA ESCA -0.107; TCGA HNSC -0.12; TCGA LUAD -0.275; TCGA LUSC -0.142; TCGA OV -0.103; TCGA PAAD -0.119; TCGA PRAD -0.107; TCGA SARC -0.116; TCGA STAD -0.166; TCGA UCEC -0.149 |
hsa-miR-497-5p | IGF2R | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; OV; PRAD; THCA; UCEC | MirTarget | TCGA BLCA -0.089; TCGA CESC -0.103; TCGA ESCA -0.112; TCGA HNSC -0.105; TCGA KIRC -0.117; TCGA OV -0.07; TCGA PRAD -0.191; TCGA THCA -0.27; TCGA UCEC -0.109 |
hsa-miR-497-5p | IARS | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.093; TCGA CESC -0.096; TCGA COAD -0.171; TCGA ESCA -0.184; TCGA HNSC -0.075; TCGA KIRC -0.125; TCGA LIHC -0.156; TCGA LUAD -0.211; TCGA LUSC -0.228; TCGA PRAD -0.059; TCGA THCA -0.071; TCGA STAD -0.256; TCGA UCEC -0.061 |
hsa-miR-497-5p | SPTLC1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.091; TCGA CESC -0.068; TCGA COAD -0.143; TCGA ESCA -0.176; TCGA HNSC -0.081; TCGA KIRC -0.09; TCGA LUAD -0.14; TCGA LUSC -0.07; TCGA PAAD -0.141; TCGA PRAD -0.09; TCGA STAD -0.172; TCGA UCEC -0.068 |
hsa-miR-497-5p | IPPK | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD | MirTarget | TCGA BLCA -0.157; TCGA BRCA -0.116; TCGA CESC -0.179; TCGA COAD -0.087; TCGA ESCA -0.263; TCGA HNSC -0.139; TCGA KIRC -0.152; TCGA LUAD -0.097; TCGA LUSC -0.243; TCGA STAD -0.094 |
hsa-miR-497-5p | CHUK | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.13; TCGA CESC -0.074; TCGA COAD -0.1; TCGA ESCA -0.109; TCGA KIRC -0.15; TCGA LIHC -0.051; TCGA LUAD -0.195; TCGA PRAD -0.132; TCGA STAD -0.203; TCGA UCEC -0.081 |
hsa-miR-497-5p | PSME3 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.067; TCGA CESC -0.108; TCGA COAD -0.129; TCGA ESCA -0.169; TCGA HNSC -0.096; TCGA KIRC -0.134; TCGA LIHC -0.146; TCGA LUAD -0.172; TCGA LUSC -0.209; TCGA OV -0.059; TCGA PRAD -0.065; TCGA STAD -0.066; TCGA UCEC -0.077 |
hsa-miR-497-5p | HN1L | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; STAD | MirTarget | TCGA BLCA -0.057; TCGA BRCA -0.197; TCGA COAD -0.148; TCGA ESCA -0.198; TCGA HNSC -0.113; TCGA KIRP -0.126; TCGA LIHC -0.069; TCGA LUAD -0.085; TCGA LUSC -0.248; TCGA OV -0.091; TCGA PAAD -0.241; TCGA STAD -0.198 |
hsa-miR-497-5p | SERBP1 | 9 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.107; TCGA COAD -0.112; TCGA ESCA -0.13; TCGA HNSC -0.083; TCGA LUAD -0.129; TCGA LUSC -0.121; TCGA PRAD -0.062; TCGA STAD -0.174; TCGA UCEC -0.092 |
hsa-miR-497-5p | ERCC6 | 9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.18; TCGA ESCA -0.195; TCGA HNSC -0.082; TCGA KIRC -0.084; TCGA LUAD -0.076; TCGA LUSC -0.132; TCGA PRAD -0.13; TCGA THCA -0.142; TCGA STAD -0.153 |
hsa-miR-497-5p | YIPF6 | 10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.108; TCGA BRCA -0.067; TCGA COAD -0.142; TCGA HNSC -0.099; TCGA KIRC -0.135; TCGA LUAD -0.232; TCGA LUSC -0.151; TCGA PRAD -0.18; TCGA STAD -0.119; TCGA UCEC -0.132 |
hsa-miR-497-5p | WBP11 | 16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.084; TCGA BRCA -0.086; TCGA CESC -0.086; TCGA COAD -0.152; TCGA ESCA -0.175; TCGA HNSC -0.055; TCGA KIRC -0.1; TCGA LIHC -0.082; TCGA LUAD -0.21; TCGA LUSC -0.156; TCGA OV -0.128; TCGA PAAD -0.089; TCGA PRAD -0.07; TCGA SARC -0.055; TCGA STAD -0.138; TCGA UCEC -0.104 |
hsa-miR-497-5p | TLK1 | 9 cancers: BLCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD | MirTarget; miRNATAP | TCGA BLCA -0.102; TCGA COAD -0.061; TCGA HNSC -0.07; TCGA KIRC -0.116; TCGA LIHC -0.064; TCGA LUAD -0.204; TCGA LUSC -0.192; TCGA PRAD -0.071; TCGA STAD -0.112 |
hsa-miR-497-5p | RAD23B | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.056; TCGA CESC -0.089; TCGA COAD -0.146; TCGA ESCA -0.261; TCGA HNSC -0.077; TCGA KIRC -0.057; TCGA LUAD -0.214; TCGA LUSC -0.149; TCGA THCA -0.263; TCGA STAD -0.174 |
hsa-miR-497-5p | CCDC85C | 11 cancers: BLCA; BRCA; CESC; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.131; TCGA BRCA -0.107; TCGA CESC -0.222; TCGA HNSC -0.205; TCGA LGG -0.059; TCGA LIHC -0.123; TCGA LUAD -0.083; TCGA LUSC -0.159; TCGA PAAD -0.214; TCGA THCA -0.073; TCGA UCEC -0.112 |
hsa-miR-497-5p | LSM11 | 9 cancers: BLCA; COAD; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.07; TCGA COAD -0.091; TCGA KIRP -0.083; TCGA LGG -0.068; TCGA LIHC -0.166; TCGA LUAD -0.089; TCGA LUSC -0.073; TCGA PRAD -0.079; TCGA STAD -0.228 |
hsa-miR-497-5p | TMEM33 | 14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.105; TCGA CESC -0.071; TCGA COAD -0.181; TCGA ESCA -0.094; TCGA HNSC -0.116; TCGA KIRC -0.192; TCGA LUAD -0.206; TCGA LUSC -0.061; TCGA OV -0.057; TCGA PAAD -0.11; TCGA PRAD -0.082; TCGA THCA -0.07; TCGA STAD -0.251; TCGA UCEC -0.075 |
hsa-miR-497-5p | PSMA5 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.129; TCGA BRCA -0.184; TCGA CESC -0.076; TCGA COAD -0.151; TCGA ESCA -0.153; TCGA HNSC -0.099; TCGA LIHC -0.068; TCGA LUAD -0.194; TCGA LUSC -0.174; TCGA THCA -0.069; TCGA STAD -0.094; TCGA UCEC -0.1 |
hsa-miR-497-5p | EIF3A | 10 cancers: BLCA; CESC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.115; TCGA CESC -0.08; TCGA KIRC -0.068; TCGA LIHC -0.066; TCGA LUAD -0.116; TCGA LUSC -0.096; TCGA PRAD -0.079; TCGA THCA -0.072; TCGA STAD -0.159; TCGA UCEC -0.064 |
hsa-miR-497-5p | YWHAQ | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.095; TCGA BRCA -0.056; TCGA CESC -0.067; TCGA COAD -0.187; TCGA ESCA -0.191; TCGA HNSC -0.161; TCGA LIHC -0.106; TCGA LUAD -0.244; TCGA LUSC -0.156; TCGA OV -0.092; TCGA PAAD -0.105; TCGA PRAD -0.053; TCGA STAD -0.144; TCGA UCEC -0.09 |
hsa-miR-497-5p | CLDN12 | 14 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.12; TCGA COAD -0.191; TCGA HNSC -0.066; TCGA KIRC -0.144; TCGA KIRP -0.16; TCGA LIHC -0.072; TCGA LUAD -0.206; TCGA LUSC -0.208; TCGA OV -0.059; TCGA PAAD -0.322; TCGA PRAD -0.14; TCGA THCA -0.109; TCGA STAD -0.317; TCGA UCEC -0.054 |
hsa-miR-497-5p | COPS2 | 9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.127; TCGA CESC -0.078; TCGA COAD -0.203; TCGA ESCA -0.184; TCGA LUAD -0.156; TCGA LUSC -0.079; TCGA PRAD -0.091; TCGA THCA -0.055; TCGA STAD -0.189 |
hsa-miR-497-5p | CAPRIN1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.1; TCGA BRCA -0.062; TCGA CESC -0.078; TCGA COAD -0.131; TCGA ESCA -0.139; TCGA HNSC -0.091; TCGA KIRC -0.087; TCGA LIHC -0.1; TCGA LUAD -0.142; TCGA LUSC -0.095; TCGA PRAD -0.088; TCGA THCA -0.107; TCGA STAD -0.182; TCGA UCEC -0.057 |
hsa-miR-497-5p | SBNO1 | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.139; TCGA CESC -0.197; TCGA COAD -0.135; TCGA ESCA -0.127; TCGA KIRC -0.261; TCGA LUAD -0.301; TCGA LUSC -0.181; TCGA PRAD -0.253; TCGA STAD -0.228 |
hsa-miR-497-5p | SSRP1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.056; TCGA CESC -0.061; TCGA COAD -0.137; TCGA ESCA -0.204; TCGA HNSC -0.098; TCGA LIHC -0.095; TCGA LUAD -0.141; TCGA LUSC -0.24; TCGA STAD -0.107; TCGA UCEC -0.054 |
hsa-miR-497-5p | SLC39A9 | 10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD | MirTarget | TCGA BLCA -0.05; TCGA COAD -0.119; TCGA ESCA -0.087; TCGA HNSC -0.086; TCGA KIRC -0.107; TCGA LUAD -0.092; TCGA PAAD -0.09; TCGA PRAD -0.085; TCGA SARC -0.06; TCGA STAD -0.091 |
hsa-miR-497-5p | SEH1L | 9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.078; TCGA CESC -0.099; TCGA COAD -0.227; TCGA ESCA -0.146; TCGA LUAD -0.196; TCGA LUSC -0.192; TCGA THCA -0.101; TCGA STAD -0.22; TCGA UCEC -0.132 |
hsa-miR-497-5p | ZBTB33 | 9 cancers: BLCA; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.073; TCGA KIRC -0.07; TCGA LIHC -0.13; TCGA LUAD -0.065; TCGA LUSC -0.152; TCGA PRAD -0.087; TCGA THCA -0.181; TCGA STAD -0.197; TCGA UCEC -0.085 |
hsa-miR-497-5p | NRBP1 | 11 cancers: BLCA; BRCA; ESCA; HNSC; LIHC; LUAD; LUSC; OV; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.067; TCGA BRCA -0.116; TCGA ESCA -0.095; TCGA HNSC -0.07; TCGA LIHC -0.15; TCGA LUAD -0.103; TCGA LUSC -0.184; TCGA OV -0.091; TCGA SARC -0.082; TCGA THCA -0.107; TCGA UCEC -0.081 |
hsa-miR-497-5p | G6PD | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; SARC; UCEC | MirTarget | TCGA BLCA -0.123; TCGA BRCA -0.214; TCGA ESCA -0.309; TCGA HNSC -0.182; TCGA KIRP -0.175; TCGA LGG -0.071; TCGA LIHC -0.388; TCGA LUSC -0.442; TCGA SARC -0.063; TCGA UCEC -0.059 |
hsa-miR-497-5p | SLC35F5 | 10 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.087; TCGA HNSC -0.103; TCGA KIRC -0.211; TCGA KIRP -0.077; TCGA LUAD -0.21; TCGA LUSC -0.209; TCGA PRAD -0.19; TCGA SARC -0.074; TCGA STAD -0.084; TCGA UCEC -0.228 |
hsa-miR-497-5p | PLAG1 | 10 cancers: BLCA; CESC; KIRC; KIRP; LIHC; OV; PRAD; SARC; THCA; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.246; TCGA CESC -0.277; TCGA KIRC -0.518; TCGA KIRP -0.386; TCGA LIHC -0.476; TCGA OV -0.289; TCGA PRAD -0.283; TCGA SARC -0.819; TCGA THCA -0.59; TCGA UCEC -0.426 |
hsa-miR-497-5p | ACTR2 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.074; TCGA BRCA -0.066; TCGA CESC -0.105; TCGA ESCA -0.078; TCGA HNSC -0.103; TCGA LUAD -0.164; TCGA LUSC -0.053; TCGA PRAD -0.097; TCGA STAD -0.165; TCGA UCEC -0.134 |
hsa-miR-497-5p | UBFD1 | 10 cancers: BLCA; BRCA; ESCA; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.054; TCGA BRCA -0.078; TCGA ESCA -0.077; TCGA LIHC -0.121; TCGA LUAD -0.095; TCGA LUSC -0.193; TCGA PAAD -0.173; TCGA THCA -0.136; TCGA STAD -0.178; TCGA UCEC -0.118 |
hsa-miR-497-5p | BAG4 | 10 cancers: BLCA; COAD; ESCA; KIRC; LUAD; LUSC; OV; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.106; TCGA COAD -0.254; TCGA ESCA -0.188; TCGA KIRC -0.19; TCGA LUAD -0.215; TCGA LUSC -0.185; TCGA OV -0.083; TCGA PRAD -0.125; TCGA THCA -0.105; TCGA STAD -0.235 |
hsa-miR-497-5p | SLC25A15 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; UCEC | MirTarget | TCGA BLCA -0.068; TCGA BRCA -0.07; TCGA CESC -0.113; TCGA COAD -0.112; TCGA ESCA -0.151; TCGA KIRC -0.166; TCGA LGG -0.067; TCGA LUAD -0.253; TCGA LUSC -0.264; TCGA UCEC -0.084 |
hsa-miR-497-5p | ARL8B | 9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; PRAD; THCA; STAD | MirTarget; miRNATAP | TCGA BLCA -0.065; TCGA CESC -0.101; TCGA ESCA -0.168; TCGA HNSC -0.056; TCGA KIRC -0.135; TCGA LIHC -0.063; TCGA PRAD -0.052; TCGA THCA -0.112; TCGA STAD -0.126 |
hsa-miR-497-5p | FAM91A1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.09; TCGA CESC -0.096; TCGA COAD -0.208; TCGA ESCA -0.18; TCGA HNSC -0.13; TCGA KIRC -0.06; TCGA LUAD -0.218; TCGA LUSC -0.194; TCGA PRAD -0.098; TCGA SARC -0.071; TCGA STAD -0.283; TCGA UCEC -0.14 |
hsa-miR-497-5p | KIF21A | 10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD | MirTarget | TCGA BLCA -0.15; TCGA BRCA -0.113; TCGA COAD -0.123; TCGA KIRC -0.242; TCGA KIRP -0.102; TCGA LIHC -0.081; TCGA LUAD -0.249; TCGA LUSC -0.291; TCGA PRAD -0.159; TCGA STAD -0.252 |
hsa-miR-497-5p | USP14 | 15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.083; TCGA BRCA -0.064; TCGA CESC -0.14; TCGA COAD -0.245; TCGA ESCA -0.157; TCGA HNSC -0.091; TCGA KIRC -0.076; TCGA LIHC -0.141; TCGA LUAD -0.232; TCGA LUSC -0.208; TCGA OV -0.077; TCGA PRAD -0.121; TCGA THCA -0.054; TCGA STAD -0.209; TCGA UCEC -0.156 |
hsa-miR-497-5p | TRIM59 | 10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.097; TCGA BRCA -0.197; TCGA COAD -0.2; TCGA ESCA -0.275; TCGA LIHC -0.215; TCGA LUAD -0.304; TCGA LUSC -0.515; TCGA THCA -0.179; TCGA STAD -0.339; TCGA UCEC -0.093 |
hsa-miR-497-5p | CEP55 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget | TCGA BLCA -0.132; TCGA BRCA -0.494; TCGA CESC -0.106; TCGA COAD -0.244; TCGA ESCA -0.532; TCGA HNSC -0.186; TCGA KIRP -0.236; TCGA LIHC -0.411; TCGA LUAD -0.615; TCGA LUSC -0.864; TCGA STAD -0.322; TCGA UCEC -0.246 |
hsa-miR-497-5p | UBE2K | 12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD | MirTarget | TCGA BLCA -0.092; TCGA COAD -0.111; TCGA ESCA -0.072; TCGA HNSC -0.05; TCGA KIRC -0.051; TCGA LIHC -0.053; TCGA LUAD -0.232; TCGA LUSC -0.097; TCGA OV -0.08; TCGA PAAD -0.088; TCGA PRAD -0.064; TCGA STAD -0.167 |
hsa-miR-497-5p | CHORDC1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; STAD | MirTarget | TCGA BLCA -0.091; TCGA BRCA -0.06; TCGA CESC -0.176; TCGA COAD -0.154; TCGA ESCA -0.249; TCGA HNSC -0.214; TCGA LIHC -0.094; TCGA LUAD -0.251; TCGA LUSC -0.286; TCGA STAD -0.323 |
hsa-miR-497-5p | FBXO22 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.112; TCGA BRCA -0.08; TCGA CESC -0.108; TCGA COAD -0.203; TCGA ESCA -0.203; TCGA HNSC -0.053; TCGA KIRC -0.117; TCGA LGG -0.104; TCGA LUAD -0.184; TCGA LUSC -0.208; TCGA PRAD -0.085; TCGA THCA -0.107; TCGA STAD -0.171 |
hsa-miR-497-5p | NUFIP2 | 9 cancers: BLCA; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; mirMAP; miRNATAP | TCGA BLCA -0.066; TCGA COAD -0.076; TCGA KIRC -0.056; TCGA KIRP -0.063; TCGA LUAD -0.12; TCGA LUSC -0.078; TCGA PRAD -0.071; TCGA STAD -0.157; TCGA UCEC -0.088 |
hsa-miR-497-5p | DCUN1D1 | 11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.098; TCGA COAD -0.098; TCGA ESCA -0.197; TCGA HNSC -0.086; TCGA KIRC -0.128; TCGA LUAD -0.235; TCGA LUSC -0.346; TCGA OV -0.075; TCGA PRAD -0.147; TCGA STAD -0.238; TCGA UCEC -0.165 |
hsa-miR-497-5p | NOB1 | 12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.111; TCGA CESC -0.12; TCGA COAD -0.132; TCGA ESCA -0.18; TCGA HNSC -0.098; TCGA KIRP -0.07; TCGA LIHC -0.07; TCGA LUAD -0.066; TCGA LUSC -0.209; TCGA SARC -0.077; TCGA THCA -0.081; TCGA STAD -0.113 |
hsa-miR-497-5p | RAP2C | 12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.093; TCGA BRCA -0.147; TCGA COAD -0.085; TCGA HNSC -0.068; TCGA KIRC -0.078; TCGA LUAD -0.144; TCGA LUSC -0.095; TCGA PRAD -0.076; TCGA SARC -0.073; TCGA THCA -0.058; TCGA STAD -0.124; TCGA UCEC -0.088 |
hsa-miR-497-5p | NAPG | 12 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.069; TCGA CESC -0.074; TCGA COAD -0.181; TCGA HNSC -0.078; TCGA KIRC -0.116; TCGA LUAD -0.103; TCGA LUSC -0.086; TCGA PAAD -0.134; TCGA PRAD -0.124; TCGA THCA -0.051; TCGA STAD -0.181; TCGA UCEC -0.087 |
hsa-miR-497-5p | GSTCD | 14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.097; TCGA BRCA -0.058; TCGA COAD -0.203; TCGA ESCA -0.118; TCGA HNSC -0.076; TCGA KIRC -0.117; TCGA LIHC -0.08; TCGA LUAD -0.278; TCGA LUSC -0.18; TCGA OV -0.124; TCGA PRAD -0.118; TCGA THCA -0.081; TCGA STAD -0.258; TCGA UCEC -0.129 |
hsa-miR-497-5p | CUL2 | 10 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.099; TCGA COAD -0.1; TCGA ESCA -0.109; TCGA LIHC -0.063; TCGA LUAD -0.213; TCGA LUSC -0.136; TCGA OV -0.057; TCGA PRAD -0.086; TCGA STAD -0.151; TCGA UCEC -0.101 |
hsa-miR-497-5p | PLEKHB2 | 11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.076; TCGA BRCA -0.089; TCGA CESC -0.073; TCGA COAD -0.082; TCGA HNSC -0.062; TCGA KIRC -0.235; TCGA LUAD -0.111; TCGA PRAD -0.125; TCGA THCA -0.112; TCGA STAD -0.111; TCGA UCEC -0.12 |
hsa-miR-497-5p | HMGA2 | 11 cancers: BLCA; BRCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.5; TCGA BRCA -0.348; TCGA HNSC -0.945; TCGA KIRP -0.684; TCGA LGG -0.559; TCGA LIHC -0.758; TCGA LUSC -1.348; TCGA OV -0.625; TCGA SARC -1.312; TCGA THCA -1.242; TCGA UCEC -0.622 |
hsa-miR-497-5p | TBP | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; OV; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.07; TCGA CESC -0.08; TCGA COAD -0.151; TCGA ESCA -0.124; TCGA KIRC -0.06; TCGA LUAD -0.097; TCGA LUSC -0.137; TCGA OV -0.139; TCGA UCEC -0.07 |
hsa-miR-497-5p | RCOR1 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; PRAD; STAD; UCEC | mirMAP | TCGA BLCA -0.14; TCGA CESC -0.139; TCGA COAD -0.091; TCGA ESCA -0.128; TCGA HNSC -0.232; TCGA LUAD -0.084; TCGA PRAD -0.091; TCGA STAD -0.133; TCGA UCEC -0.058 |
hsa-miR-497-5p | YY1 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.103; TCGA CESC -0.103; TCGA COAD -0.088; TCGA ESCA -0.176; TCGA HNSC -0.121; TCGA LUAD -0.207; TCGA LUSC -0.202; TCGA PAAD -0.072; TCGA THCA -0.051; TCGA STAD -0.124; TCGA UCEC -0.116 |
hsa-miR-497-5p | GRSF1 | 11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.073; TCGA COAD -0.132; TCGA ESCA -0.116; TCGA KIRC -0.126; TCGA KIRP -0.054; TCGA LUAD -0.151; TCGA LUSC -0.086; TCGA PAAD -0.158; TCGA THCA -0.059; TCGA STAD -0.143; TCGA UCEC -0.083 |
hsa-miR-497-5p | MTO1 | 9 cancers: BLCA; COAD; ESCA; KIRC; LUAD; LUSC; OV; PRAD; STAD | mirMAP | TCGA BLCA -0.101; TCGA COAD -0.086; TCGA ESCA -0.138; TCGA KIRC -0.105; TCGA LUAD -0.064; TCGA LUSC -0.104; TCGA OV -0.062; TCGA PRAD -0.108; TCGA STAD -0.102 |
hsa-miR-497-5p | CDK6 | 11 cancers: BLCA; CESC; HNSC; KIRC; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.245; TCGA CESC -0.311; TCGA HNSC -0.337; TCGA KIRC -0.147; TCGA LGG -0.146; TCGA LIHC -0.34; TCGA LUSC -0.213; TCGA PRAD -0.166; TCGA SARC -0.296; TCGA STAD -0.24; TCGA UCEC -0.139 |
hsa-miR-497-5p | PCMT1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.11; TCGA BRCA -0.08; TCGA CESC -0.077; TCGA COAD -0.149; TCGA ESCA -0.167; TCGA LUAD -0.103; TCGA LUSC -0.064; TCGA OV -0.118; TCGA PAAD -0.097; TCGA PRAD -0.073; TCGA THCA -0.052; TCGA STAD -0.107; TCGA UCEC -0.114 |
hsa-miR-497-5p | MIB1 | 10 cancers: BLCA; HNSC; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.075; TCGA HNSC -0.085; TCGA LIHC -0.076; TCGA LUAD -0.153; TCGA LUSC -0.153; TCGA OV -0.089; TCGA PRAD -0.137; TCGA THCA -0.092; TCGA STAD -0.19; TCGA UCEC -0.082 |
hsa-miR-497-5p | BAZ2A | 9 cancers: BLCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; THCA; UCEC | miRNATAP | TCGA BLCA -0.066; TCGA CESC -0.117; TCGA HNSC -0.101; TCGA KIRC -0.055; TCGA LIHC -0.11; TCGA LUAD -0.135; TCGA LUSC -0.077; TCGA THCA -0.073; TCGA UCEC -0.084 |
hsa-miR-497-5p | UBE2W | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.075; TCGA CESC -0.055; TCGA COAD -0.233; TCGA HNSC -0.084; TCGA KIRC -0.098; TCGA LUAD -0.189; TCGA PRAD -0.076; TCGA STAD -0.202; TCGA UCEC -0.144 |
hsa-miR-497-5p | IPO9 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD | miRNATAP | TCGA BLCA -0.059; TCGA BRCA -0.088; TCGA COAD -0.094; TCGA ESCA -0.135; TCGA HNSC -0.063; TCGA LIHC -0.133; TCGA LUAD -0.137; TCGA LUSC -0.196; TCGA THCA -0.076; TCGA STAD -0.14 |
hsa-miR-497-5p | SLC5A3 | 10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.12; TCGA CESC -0.103; TCGA ESCA -0.211; TCGA HNSC -0.201; TCGA KIRC -0.269; TCGA LUAD -0.128; TCGA LUSC -0.182; TCGA PRAD -0.181; TCGA STAD -0.288; TCGA UCEC -0.099 |
hsa-miR-497-5p | RNF111 | 9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; PRAD; THCA; STAD | miRNATAP | TCGA BLCA -0.061; TCGA CESC -0.067; TCGA COAD -0.113; TCGA HNSC -0.059; TCGA KIRC -0.08; TCGA LUAD -0.103; TCGA PRAD -0.138; TCGA THCA -0.051; TCGA STAD -0.106 |
hsa-miR-497-5p | KPNA4 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.075; TCGA CESC -0.068; TCGA COAD -0.097; TCGA ESCA -0.159; TCGA HNSC -0.095; TCGA LUAD -0.2; TCGA LUSC -0.197; TCGA OV -0.089; TCGA PRAD -0.062; TCGA STAD -0.177; TCGA UCEC -0.118 |
hsa-miR-497-5p | FAM60A | 13 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.098; TCGA COAD -0.236; TCGA ESCA -0.147; TCGA KIRC -0.204; TCGA KIRP -0.092; TCGA LIHC -0.165; TCGA LUAD -0.338; TCGA LUSC -0.323; TCGA OV -0.158; TCGA PRAD -0.07; TCGA THCA -0.123; TCGA STAD -0.283; TCGA UCEC -0.184 |
hsa-miR-497-5p | CDC27 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.085; TCGA CESC -0.073; TCGA COAD -0.148; TCGA ESCA -0.156; TCGA HNSC -0.109; TCGA LIHC -0.07; TCGA LUAD -0.202; TCGA LUSC -0.117; TCGA PRAD -0.103; TCGA STAD -0.193; TCGA UCEC -0.094 |
hsa-miR-497-5p | VTI1A | 9 cancers: BLCA; CESC; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.057; TCGA CESC -0.051; TCGA KIRC -0.103; TCGA LIHC -0.071; TCGA LUAD -0.09; TCGA LUSC -0.071; TCGA PRAD -0.059; TCGA STAD -0.055; TCGA UCEC -0.059 |
hsa-miR-497-5p | HDGF | 12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.058; TCGA BRCA -0.204; TCGA CESC -0.11; TCGA ESCA -0.176; TCGA HNSC -0.087; TCGA LIHC -0.059; TCGA LUAD -0.201; TCGA LUSC -0.309; TCGA PAAD -0.167; TCGA THCA -0.085; TCGA STAD -0.085; TCGA UCEC -0.189 |
hsa-miR-497-5p | HNRNPA2B1 | 10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; STAD | miRNATAP | TCGA BLCA -0.051; TCGA BRCA -0.094; TCGA COAD -0.065; TCGA ESCA -0.123; TCGA KIRC -0.088; TCGA KIRP -0.055; TCGA LIHC -0.086; TCGA LUAD -0.082; TCGA LUSC -0.205; TCGA STAD -0.228 |
hsa-miR-497-5p | AMMECR1 | 12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.089; TCGA BRCA -0.108; TCGA COAD -0.085; TCGA ESCA -0.202; TCGA HNSC -0.22; TCGA KIRC -0.074; TCGA KIRP -0.061; TCGA LUAD -0.139; TCGA LUSC -0.262; TCGA THCA -0.113; TCGA STAD -0.142; TCGA UCEC -0.057 |
hsa-miR-497-5p | OTUB1 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; OV; PAAD; THCA | miRNATAP | TCGA BLCA -0.06; TCGA BRCA -0.16; TCGA CESC -0.058; TCGA COAD -0.123; TCGA ESCA -0.219; TCGA HNSC -0.132; TCGA LIHC -0.077; TCGA LUSC -0.138; TCGA OV -0.06; TCGA PAAD -0.134; TCGA THCA -0.051 |
hsa-miR-497-5p | CDCA4 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.107; TCGA BRCA -0.182; TCGA CESC -0.125; TCGA COAD -0.262; TCGA ESCA -0.363; TCGA HNSC -0.203; TCGA KIRP -0.075; TCGA LGG -0.106; TCGA LIHC -0.138; TCGA LUAD -0.303; TCGA LUSC -0.562; TCGA THCA -0.172; TCGA STAD -0.221; TCGA UCEC -0.091 |
hsa-miR-497-5p | HMGA1 | 17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; UCEC | miRNATAP | TCGA BLCA -0.172; TCGA BRCA -0.386; TCGA CESC -0.179; TCGA COAD -0.237; TCGA ESCA -0.282; TCGA HNSC -0.195; TCGA KIRC -0.255; TCGA KIRP -0.232; TCGA LGG -0.082; TCGA LIHC -0.4; TCGA LUAD -0.409; TCGA LUSC -0.544; TCGA OV -0.129; TCGA PAAD -0.288; TCGA SARC -0.218; TCGA THCA -0.403; TCGA UCEC -0.441 |
hsa-miR-497-5p | TFAP4 | 11 cancers: BLCA; CESC; COAD; ESCA; KIRP; LIHC; LUSC; OV; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.099; TCGA CESC -0.075; TCGA COAD -0.099; TCGA ESCA -0.181; TCGA KIRP -0.12; TCGA LIHC -0.108; TCGA LUSC -0.403; TCGA OV -0.068; TCGA THCA -0.106; TCGA STAD -0.148; TCGA UCEC -0.083 |
hsa-miR-497-5p | CAB39 | 9 cancers: BLCA; CESC; HNSC; KIRC; LUAD; PRAD; SARC; STAD; UCEC | miRNATAP | TCGA BLCA -0.1; TCGA CESC -0.071; TCGA HNSC -0.155; TCGA KIRC -0.098; TCGA LUAD -0.067; TCGA PRAD -0.089; TCGA SARC -0.063; TCGA STAD -0.081; TCGA UCEC -0.104 |
hsa-miR-497-5p | NAA15 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.092; TCGA CESC -0.078; TCGA COAD -0.129; TCGA ESCA -0.119; TCGA HNSC -0.093; TCGA LUAD -0.244; TCGA LUSC -0.143; TCGA OV -0.062; TCGA PRAD -0.06; TCGA STAD -0.192; TCGA UCEC -0.104 |
hsa-miR-497-5p | KLC2 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA; STAD | miRNATAP | TCGA BLCA -0.087; TCGA BRCA -0.199; TCGA CESC -0.092; TCGA COAD -0.115; TCGA ESCA -0.263; TCGA HNSC -0.105; TCGA KIRC -0.131; TCGA LIHC -0.12; TCGA LUAD -0.089; TCGA LUSC -0.277; TCGA PAAD -0.247; TCGA THCA -0.084; TCGA STAD -0.122 |
hsa-miR-497-5p | FAM135A | 9 cancers: BLCA; KIRC; KIRP; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.201; TCGA KIRC -0.196; TCGA KIRP -0.141; TCGA LUAD -0.188; TCGA LUSC -0.186; TCGA OV -0.107; TCGA PRAD -0.196; TCGA STAD -0.205; TCGA UCEC -0.086 |
hsa-miR-497-5p | MED13 | 10 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.062; TCGA COAD -0.072; TCGA HNSC -0.081; TCGA KIRC -0.066; TCGA LUAD -0.17; TCGA LUSC -0.07; TCGA PRAD -0.093; TCGA THCA -0.251; TCGA STAD -0.155; TCGA UCEC -0.074 |
hsa-miR-497-5p | STYX | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD | miRNATAP | TCGA BLCA -0.088; TCGA CESC -0.08; TCGA COAD -0.104; TCGA ESCA -0.131; TCGA HNSC -0.116; TCGA LUAD -0.133; TCGA LUSC -0.097; TCGA PRAD -0.066; TCGA STAD -0.144 |
hsa-miR-497-5p | TAF5 | 10 cancers: BLCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC | miRNATAP | TCGA BLCA -0.06; TCGA COAD -0.139; TCGA ESCA -0.153; TCGA LGG -0.053; TCGA LIHC -0.092; TCGA LUAD -0.162; TCGA LUSC -0.202; TCGA OV -0.06; TCGA STAD -0.123; TCGA UCEC -0.096 |
hsa-miR-497-5p | SRPK1 | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA BLCA -0.087; TCGA BRCA -0.11; TCGA CESC -0.102; TCGA COAD -0.142; TCGA ESCA -0.231; TCGA KIRC -0.119; TCGA LIHC -0.245; TCGA LUAD -0.25; TCGA LUSC -0.317; TCGA PRAD -0.081; TCGA THCA -0.063; TCGA STAD -0.238; TCGA UCEC -0.156 |
hsa-miR-497-5p | GORASP2 | 10 cancers: BLCA; BRCA; CESC; COAD; LIHC; LUAD; LUSC; PAAD; PRAD; THCA | miRNATAP | TCGA BLCA -0.061; TCGA BRCA -0.09; TCGA CESC -0.074; TCGA COAD -0.131; TCGA LIHC -0.111; TCGA LUAD -0.129; TCGA LUSC -0.164; TCGA PAAD -0.138; TCGA PRAD -0.067; TCGA THCA -0.087 |
hsa-miR-497-5p | NUDC | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; OV; PAAD; STAD | miRNATAP | TCGA BLCA -0.051; TCGA BRCA -0.12; TCGA COAD -0.091; TCGA ESCA -0.135; TCGA HNSC -0.063; TCGA LUSC -0.091; TCGA OV -0.058; TCGA PAAD -0.209; TCGA STAD -0.074 |
hsa-miR-497-5p | VMA21 | 10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BLCA -0.103; TCGA COAD -0.102; TCGA ESCA -0.122; TCGA KIRC -0.062; TCGA KIRP -0.051; TCGA LUAD -0.116; TCGA LUSC -0.183; TCGA PAAD -0.099; TCGA STAD -0.327; TCGA UCEC -0.068 |
hsa-miR-497-5p | FXR1 | 9 cancers: BLCA; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC | RAID | TCGA BLCA -0.085; TCGA LIHC -0.12; TCGA LUAD -0.163; TCGA LUSC -0.396; TCGA OV -0.067; TCGA PAAD -0.135; TCGA THCA -0.071; TCGA STAD -0.199; TCGA UCEC -0.105 |
hsa-miR-497-5p | SMARCD2 | 9 cancers: BRCA; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.117; TCGA COAD -0.088; TCGA ESCA -0.119; TCGA KIRP -0.081; TCGA LIHC -0.057; TCGA LUAD -0.084; TCGA LUSC -0.204; TCGA STAD -0.077; TCGA UCEC -0.111 |
hsa-miR-497-5p | ZNF622 | 11 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; THCA; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.143; TCGA CESC -0.127; TCGA ESCA -0.108; TCGA HNSC -0.088; TCGA LGG -0.051; TCGA LIHC -0.071; TCGA LUAD -0.111; TCGA LUSC -0.093; TCGA PAAD -0.186; TCGA THCA -0.145; TCGA UCEC -0.12 |
hsa-miR-497-5p | PDIA6 | 13 cancers: BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.123; TCGA CESC -0.086; TCGA COAD -0.132; TCGA HNSC -0.112; TCGA LIHC -0.101; TCGA LUAD -0.23; TCGA LUSC -0.242; TCGA OV -0.067; TCGA PAAD -0.132; TCGA PRAD -0.125; TCGA SARC -0.089; TCGA STAD -0.069; TCGA UCEC -0.155 |
hsa-miR-497-5p | ZNRF2 | 9 cancers: BRCA; CESC; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.072; TCGA CESC -0.079; TCGA HNSC -0.064; TCGA LUAD -0.145; TCGA LUSC -0.09; TCGA PRAD -0.088; TCGA THCA -0.182; TCGA STAD -0.086; TCGA UCEC -0.145 |
hsa-miR-497-5p | PFKFB4 | 10 cancers: BRCA; CESC; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.247; TCGA CESC -0.265; TCGA ESCA -0.497; TCGA LIHC -0.384; TCGA LUAD -0.229; TCGA LUSC -0.342; TCGA PAAD -0.246; TCGA SARC -0.087; TCGA THCA -0.095; TCGA STAD -0.214 |
hsa-miR-497-5p | SGPL1 | 9 cancers: BRCA; ESCA; KIRC; LIHC; LUAD; LUSC; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.086; TCGA ESCA -0.228; TCGA KIRC -0.127; TCGA LIHC -0.074; TCGA LUAD -0.167; TCGA LUSC -0.207; TCGA SARC -0.051; TCGA THCA -0.163; TCGA STAD -0.191 |
hsa-miR-497-5p | CALU | 9 cancers: BRCA; HNSC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.085; TCGA HNSC -0.129; TCGA LIHC -0.09; TCGA LUAD -0.23; TCGA LUSC -0.21; TCGA PRAD -0.111; TCGA THCA -0.067; TCGA STAD -0.092; TCGA UCEC -0.116 |
hsa-miR-497-5p | CCNE1 | 13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.382; TCGA CESC -0.127; TCGA ESCA -0.428; TCGA HNSC -0.165; TCGA KIRC -0.13; TCGA KIRP -0.106; TCGA LGG -0.108; TCGA LIHC -0.265; TCGA LUAD -0.496; TCGA LUSC -0.873; TCGA THCA -0.098; TCGA STAD -0.422; TCGA UCEC -0.424 |
hsa-miR-497-5p | FASN | 9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; SARC; STAD; UCEC | MirTarget | TCGA BRCA -0.127; TCGA CESC -0.307; TCGA ESCA -0.204; TCGA HNSC -0.103; TCGA LGG -0.077; TCGA LIHC -0.239; TCGA SARC -0.06; TCGA STAD -0.234; TCGA UCEC -0.152 |
hsa-miR-497-5p | ARHGDIA | 9 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LGG; PAAD; SARC; THCA | MirTarget; miRNATAP | TCGA BRCA -0.171; TCGA CESC -0.068; TCGA ESCA -0.135; TCGA HNSC -0.137; TCGA KIRP -0.073; TCGA LGG -0.104; TCGA PAAD -0.18; TCGA SARC -0.072; TCGA THCA -0.063 |
hsa-miR-497-5p | UBE2V1 | 10 cancers: BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; PAAD; SARC; UCEC | MirTarget | TCGA BRCA -0.077; TCGA CESC -0.101; TCGA HNSC -0.132; TCGA LIHC -0.087; TCGA LUAD -0.081; TCGA LUSC -0.077; TCGA OV -0.144; TCGA PAAD -0.086; TCGA SARC -0.067; TCGA UCEC -0.105 |
hsa-miR-497-5p | CLSPN | 11 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.403; TCGA CESC -0.15; TCGA COAD -0.248; TCGA ESCA -0.349; TCGA HNSC -0.195; TCGA LIHC -0.398; TCGA LUAD -0.633; TCGA LUSC -0.75; TCGA THCA -0.32; TCGA STAD -0.364; TCGA UCEC -0.277 |
hsa-miR-497-5p | MAP7 | 15 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.144; TCGA CESC -0.181; TCGA COAD -0.174; TCGA ESCA -0.277; TCGA HNSC -0.122; TCGA KIRC -0.176; TCGA KIRP -0.068; TCGA LUAD -0.15; TCGA LUSC -0.253; TCGA OV -0.107; TCGA PAAD -0.227; TCGA PRAD -0.108; TCGA THCA -0.059; TCGA STAD -0.246; TCGA UCEC -0.175 |
hsa-miR-497-5p | VEGFA | 10 cancers: BRCA; CESC; COAD; HNSC; LGG; LIHC; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BRCA -0.127; TCGA CESC -0.205; TCGA COAD -0.132; TCGA HNSC -0.123; TCGA LGG -0.218; TCGA LIHC -0.094; TCGA LUSC -0.112; TCGA PAAD -0.21; TCGA STAD -0.269; TCGA UCEC -0.177 |
hsa-miR-497-5p | CABLES2 | 10 cancers: BRCA; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; UCEC | MirTarget | TCGA BRCA -0.186; TCGA KIRP -0.066; TCGA LGG -0.065; TCGA LIHC -0.104; TCGA LUAD -0.107; TCGA LUSC -0.338; TCGA OV -0.064; TCGA PAAD -0.228; TCGA THCA -0.071; TCGA UCEC -0.135 |
hsa-miR-497-5p | TMEM41A | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.098; TCGA CESC -0.088; TCGA COAD -0.102; TCGA ESCA -0.23; TCGA HNSC -0.083; TCGA KIRP -0.093; TCGA LUAD -0.09; TCGA LUSC -0.297; TCGA OV -0.062; TCGA PAAD -0.227; TCGA SARC -0.116; TCGA THCA -0.279; TCGA STAD -0.128; TCGA UCEC -0.215 |
hsa-miR-497-5p | ATXN7L3 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.065; TCGA CESC -0.085; TCGA ESCA -0.135; TCGA HNSC -0.086; TCGA KIRP -0.059; TCGA LIHC -0.179; TCGA LUAD -0.116; TCGA LUSC -0.201; TCGA OV -0.102; TCGA PAAD -0.063; TCGA UCEC -0.061 |
hsa-miR-497-5p | ZBTB9 | 12 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.115; TCGA CESC -0.143; TCGA COAD -0.127; TCGA ESCA -0.16; TCGA HNSC -0.065; TCGA KIRC -0.065; TCGA LIHC -0.207; TCGA LUAD -0.119; TCGA LUSC -0.173; TCGA PAAD -0.135; TCGA STAD -0.114; TCGA UCEC -0.105 |
hsa-miR-497-5p | CDC25A | 12 cancers: BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.282; TCGA CESC -0.106; TCGA COAD -0.253; TCGA ESCA -0.392; TCGA KIRC -0.165; TCGA LIHC -0.347; TCGA LUAD -0.565; TCGA LUSC -0.765; TCGA PAAD -0.236; TCGA SARC -0.078; TCGA STAD -0.276; TCGA UCEC -0.25 |
hsa-miR-497-5p | SNRPB2 | 10 cancers: BRCA; CESC; COAD; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget | TCGA BRCA -0.115; TCGA CESC -0.071; TCGA COAD -0.14; TCGA LIHC -0.084; TCGA LUAD -0.17; TCGA LUSC -0.118; TCGA OV -0.113; TCGA PAAD -0.107; TCGA STAD -0.093; TCGA UCEC -0.166 |
hsa-miR-497-5p | DOLPP1 | 10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; PAAD | MirTarget; miRNATAP | TCGA BRCA -0.138; TCGA ESCA -0.257; TCGA HNSC -0.068; TCGA KIRC -0.073; TCGA KIRP -0.065; TCGA LGG -0.072; TCGA LUAD -0.105; TCGA LUSC -0.281; TCGA OV -0.085; TCGA PAAD -0.175 |
hsa-miR-497-5p | MAPRE1 | 13 cancers: BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.074; TCGA CESC -0.057; TCGA ESCA -0.131; TCGA HNSC -0.098; TCGA KIRC -0.056; TCGA LIHC -0.102; TCGA LUAD -0.17; TCGA LUSC -0.152; TCGA OV -0.055; TCGA PAAD -0.085; TCGA PRAD -0.062; TCGA STAD -0.118; TCGA UCEC -0.157 |
hsa-miR-497-5p | ZDHHC23 | 9 cancers: BRCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD; UCEC | MirTarget | TCGA BRCA -0.054; TCGA KIRC -0.255; TCGA KIRP -0.156; TCGA LGG -0.256; TCGA LUAD -0.13; TCGA LUSC -0.149; TCGA PAAD -0.194; TCGA STAD -0.234; TCGA UCEC -0.106 |
hsa-miR-497-5p | CBX4 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUSC; PAAD; THCA | MirTarget; miRNATAP | TCGA BRCA -0.265; TCGA CESC -0.111; TCGA COAD -0.103; TCGA ESCA -0.115; TCGA HNSC -0.077; TCGA LGG -0.107; TCGA LIHC -0.209; TCGA LUSC -0.277; TCGA PAAD -0.244; TCGA THCA -0.054 |
hsa-miR-497-5p | CARM1 | 10 cancers: BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUSC; OV; PAAD; THCA | MirTarget | TCGA BRCA -0.149; TCGA CESC -0.078; TCGA ESCA -0.203; TCGA HNSC -0.054; TCGA LGG -0.087; TCGA LIHC -0.097; TCGA LUSC -0.205; TCGA OV -0.091; TCGA PAAD -0.152; TCGA THCA -0.089 |
hsa-miR-497-5p | GPN1 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.055; TCGA CESC -0.083; TCGA COAD -0.145; TCGA ESCA -0.132; TCGA HNSC -0.092; TCGA LIHC -0.105; TCGA LUAD -0.247; TCGA LUSC -0.234; TCGA OV -0.112; TCGA PAAD -0.08; TCGA SARC -0.078; TCGA THCA -0.118; TCGA STAD -0.061; TCGA UCEC -0.157 |
hsa-miR-497-5p | PEX13 | 10 cancers: BRCA; CESC; COAD; HNSC; LUAD; LUSC; OV; PRAD; STAD; UCEC | MirTarget | TCGA BRCA -0.09; TCGA CESC -0.09; TCGA COAD -0.117; TCGA HNSC -0.072; TCGA LUAD -0.156; TCGA LUSC -0.166; TCGA OV -0.068; TCGA PRAD -0.122; TCGA STAD -0.153; TCGA UCEC -0.066 |
hsa-miR-497-5p | CHEK1 | 12 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.193; TCGA COAD -0.206; TCGA ESCA -0.346; TCGA HNSC -0.142; TCGA KIRP -0.068; TCGA LIHC -0.289; TCGA LUAD -0.488; TCGA LUSC -0.576; TCGA PAAD -0.198; TCGA THCA -0.12; TCGA STAD -0.334; TCGA UCEC -0.16 |
hsa-miR-497-5p | DCAF7 | 9 cancers: BRCA; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA BRCA -0.076; TCGA KIRC -0.06; TCGA LIHC -0.152; TCGA LUAD -0.122; TCGA LUSC -0.099; TCGA PRAD -0.054; TCGA THCA -0.054; TCGA STAD -0.068; TCGA UCEC -0.083 |
hsa-miR-497-5p | GALNT7 | 9 cancers: BRCA; COAD; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD | MirTarget | TCGA BRCA -0.199; TCGA COAD -0.116; TCGA KIRC -0.106; TCGA KIRP -0.118; TCGA LUAD -0.167; TCGA LUSC -0.166; TCGA SARC -0.108; TCGA THCA -0.494; TCGA STAD -0.108 |
hsa-miR-497-5p | GTF3C5 | 12 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD | MirTarget | TCGA BRCA -0.093; TCGA COAD -0.101; TCGA ESCA -0.248; TCGA KIRC -0.066; TCGA KIRP -0.09; TCGA LGG -0.069; TCGA LIHC -0.084; TCGA LUAD -0.073; TCGA LUSC -0.26; TCGA OV -0.084; TCGA PAAD -0.177; TCGA STAD -0.128 |
hsa-miR-497-5p | RFWD2 | 9 cancers: BRCA; ESCA; LGG; LIHC; LUAD; LUSC; OV; STAD; UCEC | MirTarget | TCGA BRCA -0.079; TCGA ESCA -0.09; TCGA LGG -0.053; TCGA LIHC -0.095; TCGA LUAD -0.091; TCGA LUSC -0.161; TCGA OV -0.064; TCGA STAD -0.069; TCGA UCEC -0.074 |
hsa-miR-497-5p | RPUSD1 | 11 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BRCA -0.252; TCGA CESC -0.078; TCGA ESCA -0.208; TCGA HNSC -0.096; TCGA KIRP -0.087; TCGA LGG -0.071; TCGA LIHC -0.082; TCGA LUSC -0.296; TCGA OV -0.061; TCGA PAAD -0.189; TCGA UCEC -0.058 |
hsa-miR-497-5p | HMGB3 | 11 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD; UCEC | mirMAP | TCGA BRCA -0.372; TCGA ESCA -0.302; TCGA HNSC -0.113; TCGA KIRC -0.194; TCGA KIRP -0.226; TCGA LGG -0.105; TCGA LUAD -0.265; TCGA LUSC -0.573; TCGA PAAD -0.233; TCGA STAD -0.373; TCGA UCEC -0.084 |
hsa-miR-497-5p | SNX8 | 10 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; THCA; UCEC | mirMAP | TCGA BRCA -0.113; TCGA CESC -0.074; TCGA ESCA -0.122; TCGA HNSC -0.102; TCGA LIHC -0.096; TCGA LUAD -0.116; TCGA LUSC -0.122; TCGA SARC -0.061; TCGA THCA -0.195; TCGA UCEC -0.067 |
hsa-miR-497-5p | STK35 | 11 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.082; TCGA CESC -0.075; TCGA HNSC -0.098; TCGA KIRP -0.075; TCGA LIHC -0.175; TCGA LUAD -0.079; TCGA LUSC -0.181; TCGA PAAD -0.143; TCGA THCA -0.075; TCGA STAD -0.072; TCGA UCEC -0.107 |
hsa-miR-497-5p | DDA1 | 10 cancers: BRCA; CESC; ESCA; KIRP; LIHC; LUSC; OV; PAAD; THCA; UCEC | mirMAP | TCGA BRCA -0.096; TCGA CESC -0.071; TCGA ESCA -0.082; TCGA KIRP -0.071; TCGA LIHC -0.095; TCGA LUSC -0.089; TCGA OV -0.063; TCGA PAAD -0.202; TCGA THCA -0.102; TCGA UCEC -0.096 |
hsa-miR-497-5p | SURF4 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC | mirMAP | TCGA BRCA -0.088; TCGA CESC -0.081; TCGA COAD -0.108; TCGA ESCA -0.133; TCGA HNSC -0.129; TCGA LUAD -0.081; TCGA LUSC -0.068; TCGA PAAD -0.187; TCGA SARC -0.084 |
hsa-miR-497-5p | SLC35E3 | 10 cancers: BRCA; KIRC; LGG; LIHC; LUAD; LUSC; OV; PRAD; SARC; STAD | mirMAP | TCGA BRCA -0.052; TCGA KIRC -0.099; TCGA LGG -0.091; TCGA LIHC -0.158; TCGA LUAD -0.175; TCGA LUSC -0.115; TCGA OV -0.069; TCGA PRAD -0.164; TCGA SARC -0.22; TCGA STAD -0.089 |
hsa-miR-497-5p | LMNB2 | 13 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BRCA -0.23; TCGA COAD -0.104; TCGA ESCA -0.371; TCGA HNSC -0.113; TCGA KIRP -0.064; TCGA LIHC -0.177; TCGA LUAD -0.26; TCGA LUSC -0.41; TCGA PAAD -0.191; TCGA SARC -0.081; TCGA THCA -0.13; TCGA STAD -0.219; TCGA UCEC -0.1 |
hsa-miR-497-5p | E2F7 | 10 cancers: BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; THCA; STAD | miRNATAP | TCGA BRCA -0.356; TCGA COAD -0.291; TCGA ESCA -0.378; TCGA HNSC -0.205; TCGA KIRP -0.225; TCGA LIHC -0.432; TCGA LUAD -0.505; TCGA LUSC -0.926; TCGA THCA -0.296; TCGA STAD -0.491 |
hsa-miR-497-5p | SUMO3 | 10 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; THCA; UCEC | miRNATAP | TCGA BRCA -0.112; TCGA CESC -0.056; TCGA COAD -0.092; TCGA ESCA -0.14; TCGA HNSC -0.071; TCGA LUAD -0.075; TCGA LUSC -0.072; TCGA SARC -0.098; TCGA THCA -0.057; TCGA UCEC -0.068 |
hsa-miR-497-5p | SMYD5 | 12 cancers: BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | miRNATAP | TCGA BRCA -0.055; TCGA CESC -0.057; TCGA COAD -0.103; TCGA ESCA -0.136; TCGA KIRP -0.053; TCGA LIHC -0.164; TCGA LUAD -0.105; TCGA LUSC -0.274; TCGA PAAD -0.124; TCGA SARC -0.055; TCGA THCA -0.095; TCGA STAD -0.084 |
hsa-miR-497-5p | AP2A1 | 9 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA | miRNATAP | TCGA BRCA -0.161; TCGA CESC -0.105; TCGA ESCA -0.083; TCGA HNSC -0.092; TCGA LIHC -0.08; TCGA LUAD -0.071; TCGA LUSC -0.135; TCGA PAAD -0.127; TCGA THCA -0.143 |
hsa-miR-497-5p | OTX1 | 10 cancers: BRCA; COAD; ESCA; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.249; TCGA COAD -0.602; TCGA ESCA -0.434; TCGA LGG -0.212; TCGA LIHC -0.52; TCGA LUAD -0.373; TCGA LUSC -0.983; TCGA PAAD -0.365; TCGA STAD -0.386; TCGA UCEC -0.267 |
hsa-miR-497-5p | E2F3 | 9 cancers: BRCA; CESC; ESCA; LIHC; LUAD; LUSC; THCA; STAD; UCEC | miRNATAP | TCGA BRCA -0.097; TCGA CESC -0.118; TCGA ESCA -0.178; TCGA LIHC -0.133; TCGA LUAD -0.207; TCGA LUSC -0.348; TCGA THCA -0.065; TCGA STAD -0.247; TCGA UCEC -0.167 |
hsa-miR-497-5p | TXNRD1 | 9 cancers: BRCA; COAD; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.069; TCGA COAD -0.123; TCGA KIRP -0.136; TCGA LIHC -0.173; TCGA LUAD -0.457; TCGA LUSC -0.336; TCGA PRAD -0.087; TCGA STAD -0.091; TCGA UCEC -0.097 |
hsa-miR-497-5p | PDAP1 | 10 cancers: BRCA; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC | miRNATAP | TCGA BRCA -0.176; TCGA ESCA -0.15; TCGA KIRP -0.117; TCGA LGG -0.062; TCGA LIHC -0.106; TCGA LUAD -0.091; TCGA LUSC -0.282; TCGA PAAD -0.294; TCGA STAD -0.065; TCGA UCEC -0.066 |
hsa-miR-497-5p | COPS7A | 9 cancers: BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; OV; PAAD | miRNATAP | TCGA BRCA -0.103; TCGA CESC -0.054; TCGA ESCA -0.188; TCGA HNSC -0.075; TCGA LIHC -0.06; TCGA LUAD -0.059; TCGA LUSC -0.139; TCGA OV -0.055; TCGA PAAD -0.216 |
hsa-miR-497-5p | CRKL | 9 cancers: CESC; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.081; TCGA ESCA -0.138; TCGA HNSC -0.121; TCGA LIHC -0.109; TCGA LUAD -0.14; TCGA LUSC -0.231; TCGA THCA -0.053; TCGA STAD -0.16; TCGA UCEC -0.081 |
hsa-miR-497-5p | AVL9 | 11 cancers: CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.123; TCGA ESCA -0.134; TCGA HNSC -0.182; TCGA KIRC -0.166; TCGA LIHC -0.211; TCGA LUAD -0.244; TCGA LUSC -0.274; TCGA PRAD -0.133; TCGA THCA -0.096; TCGA STAD -0.16; TCGA UCEC -0.114 |
hsa-miR-497-5p | APLN | 9 cancers: CESC; COAD; ESCA; HNSC; LIHC; PAAD; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.488; TCGA COAD -0.304; TCGA ESCA -0.495; TCGA HNSC -0.495; TCGA LIHC -0.774; TCGA PAAD -0.959; TCGA THCA -0.149; TCGA STAD -0.383; TCGA UCEC -0.156 |
hsa-miR-497-5p | ATF6 | 10 cancers: CESC; COAD; HNSC; KIRC; LUAD; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA CESC -0.067; TCGA COAD -0.104; TCGA HNSC -0.06; TCGA KIRC -0.087; TCGA LUAD -0.111; TCGA OV -0.056; TCGA PRAD -0.195; TCGA THCA -0.072; TCGA STAD -0.097; TCGA UCEC -0.106 |
hsa-miR-497-5p | ATP13A3 | 9 cancers: CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA CESC -0.093; TCGA COAD -0.075; TCGA ESCA -0.179; TCGA HNSC -0.159; TCGA LUAD -0.243; TCGA LUSC -0.282; TCGA PRAD -0.088; TCGA STAD -0.252; TCGA UCEC -0.195 |
hsa-miR-497-5p | FBXL20 | 10 cancers: CESC; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; THCA; UCEC | MirTarget | TCGA CESC -0.062; TCGA HNSC -0.083; TCGA KIRC -0.119; TCGA LUAD -0.178; TCGA LUSC -0.192; TCGA OV -0.079; TCGA PAAD -0.132; TCGA PRAD -0.081; TCGA THCA -0.064; TCGA UCEC -0.056 |
hsa-miR-497-5p | VAPB | 9 cancers: CESC; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; UCEC | miRNATAP | TCGA CESC -0.102; TCGA ESCA -0.096; TCGA HNSC -0.092; TCGA KIRC -0.098; TCGA LUAD -0.153; TCGA LUSC -0.126; TCGA OV -0.083; TCGA PAAD -0.126; TCGA UCEC -0.097 |
hsa-miR-497-5p | NAA25 | 11 cancers: CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | miRNATAP | TCGA CESC -0.103; TCGA COAD -0.157; TCGA ESCA -0.156; TCGA KIRC -0.061; TCGA KIRP -0.098; TCGA LIHC -0.131; TCGA LUAD -0.243; TCGA LUSC -0.213; TCGA PRAD -0.072; TCGA STAD -0.332; TCGA UCEC -0.111 |
hsa-miR-497-5p | SUZ12 | 9 cancers: COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.186; TCGA ESCA -0.115; TCGA KIRC -0.087; TCGA LIHC -0.102; TCGA LUAD -0.258; TCGA LUSC -0.217; TCGA PRAD -0.113; TCGA STAD -0.26; TCGA UCEC -0.111 |
hsa-miR-497-5p | POLR3F | 10 cancers: COAD; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.138; TCGA KIRP -0.074; TCGA LGG -0.067; TCGA LIHC -0.116; TCGA LUAD -0.127; TCGA LUSC -0.116; TCGA OV -0.082; TCGA PAAD -0.092; TCGA STAD -0.163; TCGA UCEC -0.096 |
hsa-miR-497-5p | CPD | 11 cancers: COAD; KIRP; LIHC; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.09; TCGA KIRP -0.093; TCGA LIHC -0.152; TCGA LUAD -0.336; TCGA LUSC -0.089; TCGA OV -0.084; TCGA PRAD -0.208; TCGA SARC -0.073; TCGA THCA -0.228; TCGA STAD -0.099; TCGA UCEC -0.129 |
hsa-miR-497-5p | SUPT16H | 9 cancers: COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.15; TCGA ESCA -0.138; TCGA HNSC -0.067; TCGA KIRC -0.065; TCGA LIHC -0.065; TCGA LUAD -0.142; TCGA LUSC -0.143; TCGA STAD -0.2; TCGA UCEC -0.071 |
hsa-miR-497-5p | COPS7B | 10 cancers: COAD; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; THCA; STAD | MirTarget; miRNATAP | TCGA COAD -0.078; TCGA KIRC -0.064; TCGA KIRP -0.103; TCGA LGG -0.058; TCGA LIHC -0.154; TCGA LUAD -0.083; TCGA LUSC -0.203; TCGA PAAD -0.129; TCGA THCA -0.056; TCGA STAD -0.1 |
hsa-miR-497-5p | DPY19L4 | 9 cancers: COAD; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA COAD -0.169; TCGA KIRC -0.1; TCGA LUAD -0.16; TCGA LUSC -0.113; TCGA PRAD -0.127; TCGA SARC -0.067; TCGA THCA -0.065; TCGA STAD -0.235; TCGA UCEC -0.052 |
hsa-miR-497-5p | ARMC8 | 9 cancers: COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC | MirTarget; miRNATAP | TCGA COAD -0.062; TCGA ESCA -0.089; TCGA HNSC -0.056; TCGA KIRC -0.083; TCGA LUAD -0.128; TCGA LUSC -0.118; TCGA PRAD -0.072; TCGA STAD -0.089; TCGA UCEC -0.087 |
hsa-miR-497-5p | CD2AP | 9 cancers: COAD; HNSC; KIRC; LIHC; LUAD; PRAD; THCA; STAD; UCEC | miRNATAP | TCGA COAD -0.127; TCGA HNSC -0.093; TCGA KIRC -0.101; TCGA LIHC -0.125; TCGA LUAD -0.192; TCGA PRAD -0.164; TCGA THCA -0.089; TCGA STAD -0.222; TCGA UCEC -0.16 |
hsa-miR-497-5p | PPP1R2 | 9 cancers: ESCA; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC | MirTarget | TCGA ESCA -0.085; TCGA LIHC -0.075; TCGA LUAD -0.091; TCGA LUSC -0.127; TCGA OV -0.093; TCGA PRAD -0.089; TCGA THCA -0.077; TCGA STAD -0.12; TCGA UCEC -0.062 |
hsa-miR-497-5p | SLC44A1 | 9 cancers: ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD | mirMAP | TCGA ESCA -0.252; TCGA HNSC -0.126; TCGA KIRC -0.11; TCGA LUAD -0.186; TCGA LUSC -0.216; TCGA PRAD -0.07; TCGA SARC -0.093; TCGA THCA -0.107; TCGA STAD -0.18 |
hsa-miR-497-5p | WIPI2 | 9 cancers: HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; UCEC | MirTarget; miRNATAP | TCGA HNSC -0.08; TCGA KIRC -0.099; TCGA KIRP -0.109; TCGA LIHC -0.071; TCGA LUAD -0.058; TCGA LUSC -0.102; TCGA OV -0.072; TCGA PAAD -0.199; TCGA UCEC -0.078 |
Enriched cancer pathways of putative targets