microRNA information: hsa-miR-502-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-502-5p | miRbase |
| Accession: | MIMAT0002873 | miRbase |
| Precursor name: | hsa-mir-502 | miRbase |
| Precursor accession: | MI0003186 | miRbase |
| Symbol: | MIR502 | HGNC |
| RefSeq ID: | NR_030226 | GenBank |
| Sequence: | AUCCUUGCUAUCUGGGUGCUA |
Reported expression in cancers: hsa-miR-502-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-502-5p | colon cancer | downregulation | "Inhibition of autophagy and tumor growth in colon ......" | 22580605 |
Reported cancer pathway affected by hsa-miR-502-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-502-5p | breast cancer | Apoptosis pathway | "Suppressive role of miR 502 5p in breast cancer vi ......" | 24677135 | Luciferase |
| hsa-miR-502-5p | breast cancer | cell cycle pathway | "Our previous research and extensive epidemiologica ......" | 27080302 | |
| hsa-miR-502-5p | colon cancer | cell cycle pathway | "Inhibition of autophagy and tumor growth in colon ......" | 22580605 | |
| hsa-miR-502-5p | esophageal cancer | Apoptosis pathway | "miR 502 medaited histone methyltransferase SET8 ex ......" | 27605386 | |
| hsa-miR-502-5p | liver cancer | cell cycle pathway; Apoptosis pathway | "miR 502 inhibits cell proliferation and tumor grow ......" | 26163264 |
Reported cancer prognosis affected by hsa-miR-502-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-502-5p | breast cancer | malignant trasformation | "Suppressive role of miR 502 5p in breast cancer vi ......" | 24677135 | Luciferase |
| hsa-miR-502-5p | breast cancer | cell migration | "Our previous research and extensive epidemiologica ......" | 27080302 | |
| hsa-miR-502-5p | colon cancer | progression | "Inhibition of autophagy and tumor growth in colon ......" | 22580605 | |
| hsa-miR-502-5p | esophageal cancer | poor survival | "miR 502 medaited histone methyltransferase SET8 ex ......" | 27605386 | |
| hsa-miR-502-5p | lung squamous cell cancer | poor survival | "Genetic variation in a microRNA 502 minding site i ......" | 24146953 | Luciferase |
Reported gene related to hsa-miR-502-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-502-5p | breast cancer | SETD8 | "Our previous research and extensive epidemiologica ......" | 27080302 |
| hsa-miR-502-5p | breast cancer | SETD8 | "An miR 502 binding site single nucleotide polymorp ......" | 19789321 |
| hsa-miR-502-5p | cervical and endocervical cancer | SETD8 | "Association of a miR 502 binding site single nucle ......" | 25169478 |
| hsa-miR-502-5p | esophageal cancer | SETD8 | "miR 502 medaited histone methyltransferase SET8 ex ......" | 27605386 |
| hsa-miR-502-5p | kidney renal cell cancer | SETD8 | "Polymorphism at the miR 502 binding site in the 3' ......" | 27346408 |
| hsa-miR-502-5p | liver cancer | SETD8 | "A polymorphism at the miR 502 binding site in the ......" | 22095217 |
| hsa-miR-502-5p | lung squamous cell cancer | SETD8 | "A polymorphism at the miR 502 binding site in the ......" | 22969952 |
| hsa-miR-502-5p | lung squamous cell cancer | SETD8 | "Genetic variation in a microRNA 502 minding site i ......" | 24146953 |
| hsa-miR-502-5p | lung squamous cell cancer | SETD8 | "Association of miR 502 binding site single nucleot ......" | 24374662 |
| hsa-miR-502-5p | lymphoma | SETD8 | "Prognostic value of microRNA 502 binding site SNP ......" | 25343552 |
| hsa-miR-502-5p | ovarian cancer | SETD8 | "A polymorphism at the miR 502 binding site in the ......" | 22867998 |
| hsa-miR-502-5p | cervical and endocervical cancer | TP53 | "Association of a miR 502 binding site single nucle ......" | 25169478 |
| hsa-miR-502-5p | colon cancer | TP53 | "In addition the expression of miR-502 was regulate ......" | 22580605 |
| hsa-miR-502-5p | lung squamous cell cancer | TP53 | "Association of miR 502 binding site single nucleot ......" | 24374662 |
| hsa-miR-502-5p | colon cancer | DHODH | "A number of other miR-502 suppressed mRNA targets ......" | 22580605 |
| hsa-miR-502-5p | liver cancer | PIK3CG | "Phosphoinositide 3-kinase catalytic subunit gamma ......" | 26163264 |
| hsa-miR-502-5p | colon cancer | RAB1B | "In this study we discover a novel mechanism of aut ......" | 22580605 |
| hsa-miR-502-5p | lymphoma | RTEL1 | "We evaluated the effect of single-nucleotide polym ......" | 25343552 |
| hsa-miR-502-5p | lung squamous cell cancer | SCLC1 | "We analysed a single nucleotide polymorphism rs169 ......" | 22969952 |
| hsa-miR-502-5p | breast cancer | TRAF2 | "Suppressive role of miR 502 5p in breast cancer vi ......" | 24677135 |
Expression profile in cancer corhorts:
