microRNA information: hsa-miR-503-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-503-5p | miRbase |
Accession: | MIMAT0002874 | miRbase |
Precursor name: | hsa-mir-503 | miRbase |
Precursor accession: | MI0003188 | miRbase |
Symbol: | MIR503 | HGNC |
RefSeq ID: | NR_030228 | GenBank |
Sequence: | UAGCAGCGGGAACAGUUCUGCAG |
Reported expression in cancers: hsa-miR-503-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-503-5p | breast cancer | downregulation | "Aberrant expression of miR-503 has been reported i ......" | 26047605 | |
hsa-miR-503-5p | cervical and endocervical cancer | downregulation | "Reduced expression of miR 503 is associated with p ......" | 26592830 | qPCR |
hsa-miR-503-5p | colorectal cancer | downregulation | "MicroRNA miR-503 is downregulated in several cance ......" | 26999740 | |
hsa-miR-503-5p | esophageal cancer | upregulation | "MicroRNA 503 promotes tumor progression and acts a ......" | 25750296 | Reverse transcription PCR |
hsa-miR-503-5p | gastric cancer | downregulation | "MiR-503 expression was measured by quantitative re ......" | 24931256 | qPCR |
hsa-miR-503-5p | liver cancer | downregulation | "Downregulation of microRNA-503 has been observed i ......" | 23967867 | |
hsa-miR-503-5p | prostate cancer | downregulation | "Although increasing evidence demonstrated that der ......" | 27267060 | |
hsa-miR-503-5p | retinoblastoma | upregulation | "Identification of miRNAs associated with tumorigen ......" | 18818933 | Microarray; Northern blot; in situ hybridization |
hsa-miR-503-5p | thyroid cancer | downregulation | "Of these miR-296 and miR-139 were down-regulated a ......" | 19926710 |
Reported cancer pathway affected by hsa-miR-503-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-503-5p | breast cancer | cell cycle pathway | "MiR 503 inhibited cell proliferation of human brea ......" | 26047605 | |
hsa-miR-503-5p | colorectal cancer | Apoptosis pathway; cell cycle pathway | "miR 503 inhibits cell proliferation and induces ap ......" | 26722476 | MTT assay; Flow cytometry; Western blot; Luciferase |
hsa-miR-503-5p | endometrial cancer | cell cycle pathway | "MicroRNA 503 suppresses proliferation and cell cyc ......" | 23731275 | |
hsa-miR-503-5p | gastric cancer | Apoptosis pathway | "MiR 503 regulates cisplatin resistance of human ga ......" | 24931256 | Luciferase; Western blot |
hsa-miR-503-5p | glioblastoma | cell cycle pathway; Apoptosis pathway; PI3K/Akt signaling pathway | "MicroRNA 503 acts as a tumor suppressor in gliobla ......" | 24378652 | Luciferase |
hsa-miR-503-5p | liver cancer | cell cycle pathway | "MicroRNA 503 inhibits the G1/S transition by downr ......" | 23967867 | Western blot; Luciferase |
hsa-miR-503-5p | liver cancer | Epithelial mesenchymal transition pathway | "miR 503 suppresses metastasis of hepatocellular ca ......" | 26163260 | Luciferase; Western blot; Wound Healing Assay |
hsa-miR-503-5p | lung squamous cell cancer | Apoptosis pathway | "miR 503 regulates the resistance of non small cell ......" | 23856992 | |
hsa-miR-503-5p | lung squamous cell cancer | Apoptosis pathway | "Epigenetic silencing of MicroRNA 503 regulates FAN ......" | 24486548 | |
hsa-miR-503-5p | prostate cancer | Epithelial mesenchymal transition pathway | "GATA3 driven expression of miR 503 inhibits prosta ......" | 27267060 | |
hsa-miR-503-5p | sarcoma | Apoptosis pathway | "Reverse transcription‑quantitative polymerase ch ......" | 26461038 |
Reported cancer prognosis affected by hsa-miR-503-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-503-5p | breast cancer | staging | "Quantitative RT-PCR was used to determine expressi ......" | 23526361 | |
hsa-miR-503-5p | breast cancer | metastasis | "Microparticles Mediate the Intercellular Regulatio ......" | 25177548 | Cell migration assay |
hsa-miR-503-5p | breast cancer | drug resistance | "Using miRNA profiling we identified miR-503 which ......" | 25860935 | |
hsa-miR-503-5p | breast cancer | progression | "MiR 503 inhibited cell proliferation of human brea ......" | 26047605 | |
hsa-miR-503-5p | breast cancer | drug resistance; poor survival | "An integrative transcriptomics approach identifies ......" | 27539783 | |
hsa-miR-503-5p | cervical and endocervical cancer | worse prognosis; poor survival; recurrence | "Reduced expression of miR 503 is associated with p ......" | 26592830 | |
hsa-miR-503-5p | colorectal cancer | tumorigenesis; metastasis; tumor size; worse prognosis; staging; recurrence | "MicroRNA miR-503 is downregulated in several cance ......" | 26999740 | |
hsa-miR-503-5p | endometrial cancer | progression; poor survival; tumorigenesis | "MicroRNA 503 suppresses proliferation and cell cyc ......" | 23731275 | |
hsa-miR-503-5p | esophageal cancer | progression; worse prognosis; tumor size; poor survival; recurrence | "MicroRNA 503 promotes tumor progression and acts a ......" | 25750296 | |
hsa-miR-503-5p | gastric cancer | drug resistance | "MiR 503 regulates cisplatin resistance of human ga ......" | 24931256 | Luciferase; Western blot |
hsa-miR-503-5p | gastric cancer | metastasis; cell migration | "microRNA 503 inhibits gastric cancer cell growth a ......" | 24944699 | |
hsa-miR-503-5p | glioblastoma | cell migration; progression | "MicroRNA 503 acts as a tumor suppressor in gliobla ......" | 24378652 | Luciferase |
hsa-miR-503-5p | liver cancer | metastasis | "Analysis of microRNA expression profiling identifi ......" | 21495032 | |
hsa-miR-503-5p | liver cancer | staging; malignant trasformation; worse prognosis; poor survival | "MicroRNA 503 inhibits the G1/S transition by downr ......" | 23967867 | Western blot; Luciferase |
hsa-miR-503-5p | liver cancer | metastasis | "miR 503 regulates metastatic function through Rho ......" | 24405610 | Luciferase |
hsa-miR-503-5p | liver cancer | metastasis; progression | "miR 503 suppresses metastasis of hepatocellular ca ......" | 26163260 | Luciferase; Western blot; Wound Healing Assay |
hsa-miR-503-5p | lung squamous cell cancer | drug resistance | "miR 503 regulates the resistance of non small cell ......" | 23856992 | |
hsa-miR-503-5p | lung squamous cell cancer | drug resistance | "Epigenetic silencing of MicroRNA 503 regulates FAN ......" | 24486548 | |
hsa-miR-503-5p | lung squamous cell cancer | progression; poor survival; metastasis; malignant trasformation | "MiR 503 targets PI3K p85 and IKK β and suppresses ......" | 24550137 | |
hsa-miR-503-5p | prostate cancer | metastasis; progression | "miR 503 suppresses tumor cell proliferation and me ......" | 26231797 | Western blot; Luciferase |
hsa-miR-503-5p | prostate cancer | progression; tumorigenesis; staging; worse prognosis; cell migration | "GATA3 driven expression of miR 503 inhibits prosta ......" | 27267060 | |
hsa-miR-503-5p | retinoblastoma | tumorigenesis | "Identification of miRNAs associated with tumorigen ......" | 18818933 | |
hsa-miR-503-5p | sarcoma | tumorigenesis; poor survival | "MicroRNA 503 acts as a tumor suppressor in osteosa ......" | 25536034 |
Reported gene related to hsa-miR-503-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-503-5p | gastric cancer | BCL2 | "MiR 503 regulates cisplatin resistance of human ga ......" | 24931256 |
hsa-miR-503-5p | lung squamous cell cancer | BCL2 | "miR 503 regulates the resistance of non small cell ......" | 23856992 |
hsa-miR-503-5p | breast cancer | CCND1 | "MiR 503 inhibited cell proliferation of human brea ......" | 26047605 |
hsa-miR-503-5p | endometrial cancer | CCND1 | "MicroRNA 503 suppresses proliferation and cell cyc ......" | 23731275 |
hsa-miR-503-5p | breast cancer | ZNF217 | "We confirmed experimentally that miR-503 directly ......" | 27539783 |
hsa-miR-503-5p | prostate cancer | ZNF217 | "GATA3 driven expression of miR 503 inhibits prosta ......" | 27267060 |
hsa-miR-503-5p | liver cancer | AFP | "Low expression levels of miR-503 were associated w ......" | 23967867 |
hsa-miR-503-5p | liver cancer | ARHGEF19 | "Furthermore we demonstrated that ARHGEF19 is a dir ......" | 24405610 |
hsa-miR-503-5p | lung squamous cell cancer | ARHGEF7 | "MiR 503 targets PI3K p85 and IKK β and suppresses ......" | 24550137 |
hsa-miR-503-5p | colorectal cancer | CASR | "The putative target gene calcium-sensing receptor ......" | 26999740 |
hsa-miR-503-5p | breast cancer | CCND2 | "We then identified two targets of miR-503 CCND2 an ......" | 25860935 |
hsa-miR-503-5p | breast cancer | CCND3 | "We then identified two targets of miR-503 CCND2 an ......" | 25860935 |
hsa-miR-503-5p | colorectal cancer | E2F3 | "miR 503 inhibits cell proliferation and induces ap ......" | 26722476 |
hsa-miR-503-5p | lung squamous cell cancer | FANCA | "Epigenetic silencing of MicroRNA 503 regulates FAN ......" | 24486548 |
hsa-miR-503-5p | prostate cancer | GATA3 | "GATA3 driven expression of miR 503 inhibits prosta ......" | 27267060 |
hsa-miR-503-5p | lung squamous cell cancer | IBSP | "In the present study the level of miR-503 expressi ......" | 24486548 |
hsa-miR-503-5p | gastric cancer | IGF1R | "MiR 503 regulates cisplatin resistance of human ga ......" | 24931256 |
hsa-miR-503-5p | sarcoma | L1CAM | "MicroRNA 503 acts as a tumor suppressor in osteosa ......" | 25536034 |
hsa-miR-503-5p | endometrial cancer | PCNA | "MicroRNA 503 suppresses proliferation and cell cyc ......" | 23731275 |
hsa-miR-503-5p | liver cancer | PRMT1 | "miR 503 suppresses metastasis of hepatocellular ca ......" | 26163260 |
hsa-miR-503-5p | prostate cancer | RNF31 | "miR 503 suppresses tumor cell proliferation and me ......" | 26231797 |
hsa-miR-503-5p | breast cancer | TXK | "Microparticles Mediate the Intercellular Regulatio ......" | 25177548 |
hsa-miR-503-5p | breast cancer | TYK2 | "Microparticles Mediate the Intercellular Regulatio ......" | 25177548 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-503-5p | FGF2 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; STAD | miRNAWalker2 validate | TCGA BLCA -0.407; TCGA BRCA -0.319; TCGA COAD -0.242; TCGA ESCA -0.329; TCGA HNSC -0.222; TCGA KIRP -0.145; TCGA LGG -0.051; TCGA LUAD -0.205; TCGA LUSC -0.236; TCGA STAD -0.406 |
hsa-miR-503-5p | KIAA1671 | 10 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; OV; SARC | miRNAWalker2 validate | TCGA BLCA -0.136; TCGA BRCA -0.054; TCGA ESCA -0.129; TCGA HNSC -0.289; TCGA KIRP -0.06; TCGA LGG -0.114; TCGA LIHC -0.142; TCGA LUAD -0.13; TCGA OV -0.075; TCGA SARC -0.084 |
hsa-miR-503-5p | GREM2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUSC; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.454; TCGA BRCA -0.239; TCGA COAD -0.326; TCGA ESCA -0.912; TCGA HNSC -0.566; TCGA LGG -0.167; TCGA LIHC -0.398; TCGA LUSC -0.349; TCGA SARC -0.368; TCGA THCA -0.155; TCGA STAD -0.767 |
hsa-miR-503-5p | SCN2B | 9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.46; TCGA BRCA -0.393; TCGA ESCA -0.582; TCGA HNSC -0.182; TCGA LGG -0.239; TCGA LUAD -0.26; TCGA LUSC -0.332; TCGA SARC -0.38; TCGA STAD -0.737 |
hsa-miR-503-5p | LONRF2 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.5; TCGA BRCA -0.25; TCGA COAD -0.259; TCGA ESCA -0.783; TCGA HNSC -0.612; TCGA LUAD -0.195; TCGA LUSC -0.198; TCGA SARC -0.686; TCGA STAD -0.792 |
hsa-miR-503-5p | KCNK3 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.413; TCGA BRCA -0.133; TCGA COAD -0.253; TCGA ESCA -0.46; TCGA HNSC -0.166; TCGA LGG -0.266; TCGA LUAD -0.304; TCGA LUSC -0.613; TCGA SARC -0.738; TCGA STAD -0.742 |
hsa-miR-503-5p | TOM1L2 | 11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.055; TCGA BRCA -0.108; TCGA COAD -0.073; TCGA ESCA -0.278; TCGA HNSC -0.104; TCGA LGG -0.101; TCGA LUAD -0.11; TCGA LUSC -0.195; TCGA PAAD -0.095; TCGA SARC -0.141; TCGA STAD -0.235 |
Enriched cancer pathways of putative targets