microRNA information: hsa-miR-504-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-504-5p | miRbase |
Accession: | MIMAT0002875 | miRbase |
Precursor name: | hsa-mir-504 | miRbase |
Precursor accession: | MI0003189 | miRbase |
Symbol: | MIR504 | HGNC |
RefSeq ID: | NR_030229 | GenBank |
Sequence: | AGACCCUGGUCUGCACUCUAUC |
Reported expression in cancers: hsa-miR-504-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-504-5p | lung squamous cell cancer | deregulation | "Locked nucleic acids miRNA microarray expression p ......" | 20508945 | Microarray |
Reported cancer pathway affected by hsa-miR-504-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-504-5p | NA | NA | "NA ......" | NA | NA |
hsa-miR-504-5p | " ......" |
Reported cancer prognosis affected by hsa-miR-504-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-504-5p | lymphoma | differentiation | "Three cases of ALK-negative anaplastic large cell ......" | 26705180 |
Reported gene related to hsa-miR-504-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-504-5p | gastric cancer | TFF1 | "TFF1 activates p53 through down regulation of miR ......" | 25015107 |
hsa-miR-504-5p | gastric cancer | TP53 | "TFF1 activates p53 through down regulation of miR ......" | 25015107 |