microRNA information: hsa-miR-509-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-509-3p | miRbase |
| Accession: | MIMAT0002881 | miRbase |
| Precursor name: | hsa-mir-509-1 | miRbase |
| Precursor accession: | MI0003196 | miRbase |
| Symbol: | MIR509-1 | HGNC |
| RefSeq ID: | NR_030236 | GenBank |
| Sequence: | UGAUUGGUACGUCUGUGGGUAG |
Reported expression in cancers: hsa-miR-509-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-509-3p | breast cancer | upregulation | "Our results revealed that the miR-509 is highly ex ......" | 25659578 | |
| hsa-miR-509-3p | gastric cancer | downregulation | "Aberrant expression of miR-509-3p has been reporte ......" | 27697095 | |
| hsa-miR-509-3p | kidney renal cell cancer | downregulation | "Identification of miR 508 3p and miR 509 3p that a ......" | 22369946 |
Reported cancer pathway affected by hsa-miR-509-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-509-3p | breast cancer | Apoptosis pathway | "Overexpression of miR 509 Increases Apoptosis and ......" | 27656833 | |
| hsa-miR-509-3p | kidney renal cell cancer | Apoptosis pathway | "Identification of miR 508 3p and miR 509 3p that a ......" | 22369946 | |
| hsa-miR-509-3p | kidney renal cell cancer | Apoptosis pathway | "Tumor suppressive miR 509 5p contributes to cell m ......" | 23619562 | |
| hsa-miR-509-3p | ovarian cancer | Apoptosis pathway | "MicroRNA 509 3p increases the sensitivity of epith ......" | 26786897 | Luciferase |
Reported cancer prognosis affected by hsa-miR-509-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-509-3p | breast cancer | metastasis | "miR 509 suppresses brain metastasis of breast canc ......" | 25659578 | |
| hsa-miR-509-3p | breast cancer | malignant trasformation | "Overexpression of miR 509 Increases Apoptosis and ......" | 27656833 | |
| hsa-miR-509-3p | gastric cancer | poor survival; progression | "MicroRNA 509 3p inhibits cancer cell proliferation ......" | 27697095 | |
| hsa-miR-509-3p | kidney renal cell cancer | cell migration | "Identification of miR 508 3p and miR 509 3p that a ......" | 22369946 | |
| hsa-miR-509-3p | kidney renal cell cancer | cell migration | "Tumor suppressive miR 509 5p contributes to cell m ......" | 23619562 | |
| hsa-miR-509-3p | ovarian cancer | progression; poor survival | "miR 509 3p is clinically significant and strongly ......" | 27036018 |
Reported gene related to hsa-miR-509-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-509-3p | breast cancer | TNF | "miR 509 suppresses brain metastasis of breast canc ......" | 25659578 |
| hsa-miR-509-3p | breast cancer | TNF | "Overexpression of miR 509 Increases Apoptosis and ......" | 27656833 |
| hsa-miR-509-3p | gastric cancer | XIAP | "MicroRNA 509 3p inhibits cancer cell proliferation ......" | 27697095 |
| hsa-miR-509-3p | ovarian cancer | XIAP | "The regulation of XIAP by miR-509-3p was investiga ......" | 26786897 |
| hsa-miR-509-3p | colorectal cancer | BPIFA4P | "Furthermore functional assays showed that the C to ......" | 26010608 |
| hsa-miR-509-3p | colorectal cancer | CD44 | "Furthermore functional assays showed that the C to ......" | 26010608 |
| hsa-miR-509-3p | kidney renal cell cancer | LARP6 | "The results demonstrated that the expression level ......" | 25815776 |
| hsa-miR-509-3p | kidney renal cell cancer | MAP2K6 | "MicroRNA 509 3p inhibits cancer cell proliferation ......" | 25815776 |
| hsa-miR-509-3p | kidney renal cell cancer | MAP3K8 | "Luciferase reporter assays revealed that the overe ......" | 25815776 |
| hsa-miR-509-3p | lung cancer | PLK1 | "MiR 509 3 5p causes aberrant mitosis and anti prol ......" | 27498003 |
| hsa-miR-509-3p | breast cancer | RHOC | "miR 509 suppresses brain metastasis of breast canc ......" | 25659578 |
| hsa-miR-509-3p | ovarian cancer | YAP1 | "We validated the Hippo pathway effector YAP1 as a ......" | 27036018 |
Expression profile in cancer corhorts:
