microRNA information: hsa-miR-514a-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-514a-3p | miRbase |
Accession: | MIMAT0002883 | miRbase |
Precursor name: | hsa-mir-514a-1 | miRbase |
Precursor accession: | MI0003198 | miRbase |
Symbol: | NA | HGNC |
RefSeq ID: | NA | GenBank |
Sequence: | AUUGACACUUCUGUGAGUAGA |
Reported expression in cancers: hsa-miR-514a-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-514a-3p | kidney renal cell cancer | downregulation | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 |
Reported cancer pathway affected by hsa-miR-514a-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-514a-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-514a-3p | kidney renal cell cancer | metastasis; malignant trasformation; recurrence | "miR-122 miR-141 miR-155 miR-184 miR-200c miR-210 m ......" | 23178446 | |
hsa-miR-514a-3p | melanoma | poor survival | "miR 514a regulates the tumour suppressor NF1 and m ......" | 25980496 | Luciferase |
Reported gene related to hsa-miR-514a-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-514a-3p | melanoma | NF1 | "miR 514a regulates the tumour suppressor NF1 and m ......" | 25980496 |
Expression profile in cancer corhorts: