microRNA information: hsa-miR-519b-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-519b-3p | miRbase |
| Accession: | MIMAT0002837 | miRbase |
| Precursor name: | hsa-mir-519b | miRbase |
| Precursor accession: | MI0003151 | miRbase |
| Symbol: | MIR519B | HGNC |
| RefSeq ID: | NR_030191 | GenBank |
| Sequence: | AAAGUGCAUCCUUUUAGAGGUU |
Reported expression in cancers: hsa-miR-519b-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-519b-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-519b-3p | colorectal cancer | Apoptosis pathway | "We used real-time PCR and western blot to measure ......" | 26792278 | Western blot; Flow cytometry; MTT assay |
Reported cancer prognosis affected by hsa-miR-519b-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-519b-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-519b-3p | gastric cancer | ELAVL1 | "MiR 519 inhibits gastric cancer cell activity thro ......" | 26819420 |
| hsa-miR-519b-3p | colorectal cancer | ORAI1 | "Moreover cell proliferation and apoptosis were mea ......" | 26792278 |