microRNA information: hsa-miR-520a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-520a-3p | miRbase |
| Accession: | MIMAT0002834 | miRbase |
| Precursor name: | hsa-mir-520a | miRbase |
| Precursor accession: | MI0003149 | miRbase |
| Symbol: | MIR520A | HGNC |
| RefSeq ID: | NR_030189 | GenBank |
| Sequence: | AAAGUGCUUCCCUUUGGACUGU |
Reported expression in cancers: hsa-miR-520a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-520a-3p | liver cancer | upregulation | "Overexpression of miR-218 or miR-520a inhibited ce ......" | 25816091 |
Reported cancer pathway affected by hsa-miR-520a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-520a-3p | liver cancer | cell cycle pathway | "MicroRNA 218 and microRNA 520a inhibit cell prolif ......" | 25816091 | Luciferase |
| hsa-miR-520a-3p | lung squamous cell cancer | Apoptosis pathway | "The microRNA 520a 3p inhibits proliferation apopto ......" | 25973317 | MTT assay; Transwell assay; Luciferase; Western blot |
Reported cancer prognosis affected by hsa-miR-520a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-520a-3p | colorectal cancer | tumorigenesis | "Recent evidence suggests that miR-520 family has a ......" | 26101709 | |
| hsa-miR-520a-3p | liver cancer | progression | "MicroRNA 218 and microRNA 520a inhibit cell prolif ......" | 25816091 | Luciferase |
| hsa-miR-520a-3p | lung squamous cell cancer | metastasis; staging; worse prognosis; cell migration | "The microRNA 520a 3p inhibits proliferation apopto ......" | 25973317 | MTT assay; Transwell assay; Luciferase; Western blot |
Reported gene related to hsa-miR-520a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-520a-3p | liver cancer | E2F2 | "MicroRNA 218 and microRNA 520a inhibit cell prolif ......" | 25816091 |
| hsa-miR-520a-3p | liver cancer | E2F2 | "An ANCCA/PRO2000 miR 520a E2F2 regulatory loop as ......" | 27239961 |
| hsa-miR-520a-3p | esophageal cancer | ERBB4 | "miR 520a regulates ErbB4 expression and suppresses ......" | 24589589 |
| hsa-miR-520a-3p | lung squamous cell cancer | HOXD8 | "microRNA 520a 3p inhibits proliferation and cancer ......" | 27748920 |
| hsa-miR-520a-3p | lung squamous cell cancer | MAP3K2 | "The microRNA 520a 3p inhibits proliferation apopto ......" | 25973317 |
| hsa-miR-520a-3p | liver cancer | PFKP | "Mechanistically TARDBP suppressed expression of th ......" | 23389994 |
| hsa-miR-520a-3p | colorectal cancer | PIK3CA | "A functional variant at miR 520a binding site in P ......" | 25834816 |
| hsa-miR-520a-3p | lung squamous cell cancer | SCLC1 | "In the present study we found that miR-520a-3p exp ......" | 27748920 |
| hsa-miR-520a-3p | liver cancer | TARDBP | "Mechanistically TARDBP suppressed expression of th ......" | 23389994 |