microRNA information: hsa-miR-520d-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-520d-3p | miRbase |
Accession: | MIMAT0002856 | miRbase |
Precursor name: | hsa-mir-520d | miRbase |
Precursor accession: | MI0003164 | miRbase |
Symbol: | MIR520D | HGNC |
RefSeq ID: | NR_030204 | GenBank |
Sequence: | AAAGUGCUUCUCUUUGGUGGGU |
Reported expression in cancers: hsa-miR-520d-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-520d-3p | NA | NA | "NA ......" | NA | NA |
hsa-miR-520d-3p | " ......" |
Reported cancer pathway affected by hsa-miR-520d-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-520d-3p | gastric cancer | cell cycle pathway | "MicroRNA 520d 3p inhibits gastric cancer cell prol ......" | 25063221 | Wound Healing Assay; Luciferase |
Reported cancer prognosis affected by hsa-miR-520d-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-520d-3p | B cell lymphoma | staging; drug resistance | "In the discovery phase real-time polymerase chain ......" | 24858372 | |
hsa-miR-520d-3p | colorectal cancer | metastasis | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 | |
hsa-miR-520d-3p | gastric cancer | staging; metastasis; poor survival; progression | "MicroRNA 520d 3p inhibits gastric cancer cell prol ......" | 25063221 | Wound Healing Assay; Luciferase |
Reported gene related to hsa-miR-520d-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-520d-3p | gastric cancer | EPHA2 | "MicroRNA 520d 3p inhibits gastric cancer cell prol ......" | 25063221 |
hsa-miR-520d-3p | ovarian cancer | EPHA2 | "We identified miR-520d-3p as a tumor suppressor up ......" | 24002999 |
hsa-miR-520d-3p | colorectal cancer | CTHRC1 | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 |
hsa-miR-520d-3p | ovarian cancer | EPHA1 | "This synergy is at least in part due to miR-520d-3 ......" | 24002999 |
hsa-miR-520d-3p | ovarian cancer | EPHB2 | "This synergy is at least in part due to miR-520d-3 ......" | 24002999 |
hsa-miR-520d-3p | gastric cancer | MMP9 | "Moreover c-Myc CyclinD1 and matrix metalloproteina ......" | 25063221 |
hsa-miR-520d-3p | gastric cancer | MYC | "Moreover c-Myc CyclinD1 and matrix metalloproteina ......" | 25063221 |
hsa-miR-520d-3p | colorectal cancer | SP1 | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 |