microRNA information: hsa-miR-520d-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-520d-5p | miRbase |
| Accession: | MIMAT0002855 | miRbase |
| Precursor name: | hsa-mir-520d | miRbase |
| Precursor accession: | MI0003164 | miRbase |
| Symbol: | MIR520D | HGNC |
| RefSeq ID: | NR_030204 | GenBank |
| Sequence: | CUACAAAGGGAAGCCCUUUC |
Reported expression in cancers: hsa-miR-520d-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-520d-5p | colorectal cancer | downregulation | "In the present study we investigated the expressio ......" | 26101709 | qPCR |
Reported cancer pathway affected by hsa-miR-520d-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-520d-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 | Luciferase; Western blot |
Reported cancer prognosis affected by hsa-miR-520d-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-520d-5p | colorectal cancer | metastasis; progression | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 | Luciferase; Western blot |
Reported gene related to hsa-miR-520d-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-520d-5p | colorectal cancer | CTHRC1 | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 |
| hsa-miR-520d-5p | gastric cancer | EPHA2 | "MicroRNA 520d 3p inhibits gastric cancer cell prol ......" | 25063221 |
| hsa-miR-520d-5p | colorectal cancer | SP1 | "SP1 mediated microRNA 520d 5p suppresses tumor gro ......" | 26101709 |