microRNA information: hsa-miR-520h
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-520h | miRbase |
| Accession: | MIMAT0002867 | miRbase |
| Precursor name: | hsa-mir-520h | miRbase |
| Precursor accession: | MI0003175 | miRbase |
| Symbol: | MIR520H | HGNC |
| RefSeq ID: | NR_030215 | GenBank |
| Sequence: | ACAAAGUGCUUCCCUUUAGAGU |
Reported expression in cancers: hsa-miR-520h
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-520h | gastric cancer | upregulation | "From the set of the 29 microRNAs of interest we fo ......" | 27081844 |
Reported cancer pathway affected by hsa-miR-520h
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-520h | breast cancer | Apoptosis pathway | "miR 520h is crucial for DAPK2 regulation and breas ......" | 25982274 |
Reported cancer prognosis affected by hsa-miR-520h
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-520h | breast cancer | progression; drug resistance; metastasis; worse prognosis | "miR 520h is crucial for DAPK2 regulation and breas ......" | 25982274 | |
| hsa-miR-520h | lung cancer | progression | "MiR 520h mediated FOXC2 regulation is critical for ......" | 22410781 | |
| hsa-miR-520h | lung squamous cell cancer | progression | "We found that miR-34b and miR-520h might play impo ......" | 25702651 | |
| hsa-miR-520h | pancreatic cancer | cell migration | "hsa miR 520h downregulates ABCG2 in pancreatic can ......" | 20628378 |
Reported gene related to hsa-miR-520h
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-520h | breast cancer | ABCG2 | "However ABCG2 protein expression was unchanged in ......" | 21219875 |
| hsa-miR-520h | pancreatic cancer | ABCG2 | "hsa miR 520h downregulates ABCG2 in pancreatic can ......" | 20628378 |
| hsa-miR-520h | cervical and endocervical cancer | CXCR4 | "Substantiating our findings we demonstrated that A ......" | 25047463 |
| hsa-miR-520h | breast cancer | DAPK2 | "miR 520h is crucial for DAPK2 regulation and breas ......" | 25982274 |
| hsa-miR-520h | lung cancer | FOXC2 | "MiR 520h mediated FOXC2 regulation is critical for ......" | 22410781 |