microRNA information: hsa-miR-522-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-522-3p | miRbase |
| Accession: | MIMAT0002868 | miRbase |
| Precursor name: | hsa-mir-522 | miRbase |
| Precursor accession: | MI0003177 | miRbase |
| Symbol: | MIR522 | HGNC |
| RefSeq ID: | NR_030217 | GenBank |
| Sequence: | AAAAUGGUUCCCUUUAGAGUGU |
Reported expression in cancers: hsa-miR-522-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-522-3p | liver cancer | upregulation | "miR-522 has been demonstrated to be upregulated in ......" | 26960688 | |
| hsa-miR-522-3p | lung cancer | deregulation | "Therefore we conduct to systematically identify mi ......" | 26870998 | Microarray |
Reported cancer pathway affected by hsa-miR-522-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-522-3p | liver cancer | cell cycle pathway | "miR 522 contributes to cell proliferation of hepat ......" | 26960688 | Colony formation |
| hsa-miR-522-3p | lung squamous cell cancer | Apoptosis pathway | "Downregulation of miR 522 suppresses proliferation ......" | 26783084 | Flow cytometry; MTT assay; Transwell assay; Luciferase; Western blot |
Reported cancer prognosis affected by hsa-miR-522-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-522-3p | colon cancer | drug resistance | "MicroRNA 522 reverses drug resistance of doxorubic ......" | 26043974 | |
| hsa-miR-522-3p | liver cancer | progression | "miR 522 contributes to cell proliferation of hepat ......" | 26960688 | Colony formation |
| hsa-miR-522-3p | lung squamous cell cancer | metastasis | "Downregulation of miR 522 suppresses proliferation ......" | 26783084 | Flow cytometry; MTT assay; Transwell assay; Luciferase; Western blot |
Reported gene related to hsa-miR-522-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-522-3p | colon cancer | ABCB5 | "MicroRNA 522 reverses drug resistance of doxorubic ......" | 26043974 |
| hsa-miR-522-3p | lung squamous cell cancer | DENND2D | "In addition a luciferase assay identified DENN/MAD ......" | 26783084 |
| hsa-miR-522-3p | liver cancer | DKK1 | "miR 522 contributes to cell proliferation of hepat ......" | 26960688 |
| hsa-miR-522-3p | glioblastoma | PHLPP1 | "MiR 522 contributes to cell proliferation of human ......" | 25776496 |
| hsa-miR-522-3p | glioblastoma | PPP1R3C | "We further identified PH domain leucine-rich repea ......" | 25776496 |
| hsa-miR-522-3p | liver cancer | SFRP2 | "miR 522 contributes to cell proliferation of hepat ......" | 26960688 |
| hsa-miR-522-3p | glioblastoma | TAT | "Expression of miR-522 is markedly upregulated in G ......" | 25776496 |