microRNA information: hsa-miR-525-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-525-5p | miRbase |
| Accession: | MIMAT0002838 | miRbase |
| Precursor name: | hsa-mir-525 | miRbase |
| Precursor accession: | MI0003152 | miRbase |
| Symbol: | MIR525 | HGNC |
| RefSeq ID: | NR_030192 | GenBank |
| Sequence: | CUCCAGAGGGAUGCACUUUCU |
Reported expression in cancers: hsa-miR-525-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-525-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-525-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-525-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-525-5p | liver cancer | DROSHA | "By analyzing the preferred cellular RNA targets of ......" | 26551630 |
| hsa-miR-525-5p | liver cancer | ZNF395 | "MiR 525 3p enhances the migration and invasion of ......" | 24599008 |