microRNA information: hsa-miR-532-5p

SectionIDlink
Mature name: hsa-miR-532-5pmiRbase
Accession: MIMAT0002888miRbase
Precursor name: hsa-mir-532 miRbase
Precursor accession: MI0003205miRbase
Symbol: MIR532HGNC
RefSeq ID: NR_030241GenBank
Sequence: CAUGCCUUGAGUGUAGGACCGU



Reported expression in cancers: hsa-miR-532-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-532-5p

acute myeloid leukemiaupregulation"To identify miRNAs related to therapeutic response ......"23689423Microarray; qPCR
hsa-miR-532-5p

kidney renal cell cancerderegulation"This study aims to profile dysregulated microRNA m ......"25938468Microarray
hsa-miR-532-5p

retinoblastomadownregulation"Downregulation of five miRNAs miR-146b-5p miR-532- ......"25983556



Reported cancer pathway affected by hsa-miR-532-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-532-5p

gastric cancerApoptosis pathway"To date no information was reported about the func ......"26515139Colony formation; Luciferase



Reported cancer prognosis affected by hsa-miR-532-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-532-5p

acute myeloid leukemiadrug resistance"To identify miRNAs related to therapeutic response ......"23689423
hsa-miR-532-5p

kidney renal cell cancerstaging"This study aims to profile dysregulated microRNA m ......"25938468
hsa-miR-532-5p

lung cancerstaging"Based on the results from the screening and valida ......"27036025
hsa-miR-532-5p

ovarian cancerworse prognosis; poor survival"High Expression of miR 532 5p a Tumor Suppressor L ......"26873729
hsa-miR-532-5p

retinoblastomatumorigenesis"Here the role of selected miRNAs namely miR-532-5p ......"25983556Western blot



Reported gene related to hsa-miR-532-5p

miRNAcancergenereportingPUBMED
hsa-miR-532-5p

gastric cancerRUNX3"Gain-of-function loss-of-function and luciferase a ......"26515139



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-532-5p
RUNX3
9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; PRAD; THCA; UCEC
miRNAWalker2 validate
TCGA BLCA -0.374; TCGA CESC -0.163; TCGA COAD -0.255; TCGA ESCA -0.455; TCGA KIRC -0.999; TCGA LIHC -0.334; TCGA PRAD -0.129; TCGA THCA -0.294; TCGA UCEC -0.161
hsa-miR-532-5p
RAI2
9 cancers: BLCA; BRCA; COAD; KIRP; LGG; LIHC; PRAD; THCA; STAD
MirTarget; PITA; miRNATAP
TCGA BLCA -0.541; TCGA BRCA -0.705; TCGA COAD -0.221; TCGA KIRP -0.161; TCGA LGG -0.131; TCGA LIHC -0.412; TCGA PRAD -0.11; TCGA THCA -0.329; TCGA STAD -0.688
hsa-miR-532-5p
LCA5
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; OV; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.148; TCGA BRCA -0.425; TCGA COAD -0.253; TCGA KIRC -0.159; TCGA LIHC -0.374; TCGA OV -0.1; TCGA PRAD -0.34; TCGA THCA -0.404; TCGA STAD -0.135
hsa-miR-532-5p
CD109
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
MirTarget; PITA
TCGA BLCA -0.58; TCGA CESC -0.956; TCGA COAD -0.822; TCGA ESCA -1.386; TCGA HNSC -0.323; TCGA KIRC -0.57; TCGA LUAD -0.369; TCGA LUSC -0.297; TCGA OV -0.218; TCGA PAAD -0.616; TCGA PRAD -0.249; TCGA SARC -0.272; TCGA THCA -0.888; TCGA STAD -0.548
hsa-miR-532-5p
ITGA2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA
MirTarget
TCGA BLCA -0.333; TCGA BRCA -0.309; TCGA CESC -0.852; TCGA ESCA -0.316; TCGA HNSC -0.286; TCGA LUSC -0.412; TCGA PAAD -0.338; TCGA PRAD -0.419; TCGA SARC -0.47; TCGA THCA -0.86
hsa-miR-532-5p
BTBD7
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; PRAD; SARC; STAD
MirTarget; PITA
TCGA BLCA -0.072; TCGA BRCA -0.185; TCGA COAD -0.079; TCGA ESCA -0.098; TCGA HNSC -0.143; TCGA KIRP -0.177; TCGA PRAD -0.142; TCGA SARC -0.12; TCGA STAD -0.062
hsa-miR-532-5p
SLITRK6
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PRAD; THCA; STAD
MirTarget; PITA
TCGA BLCA -0.304; TCGA BRCA -1.185; TCGA COAD -0.576; TCGA ESCA -1.137; TCGA HNSC -0.836; TCGA LGG -0.514; TCGA LIHC -0.856; TCGA LUAD -0.617; TCGA LUSC -0.371; TCGA OV -0.401; TCGA PRAD -0.439; TCGA THCA -0.991; TCGA STAD -0.965
hsa-miR-532-5p
CHD9
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; OV; PRAD; STAD
MirTarget; PITA; miRNATAP
TCGA BLCA -0.23; TCGA BRCA -0.19; TCGA COAD -0.104; TCGA ESCA -0.318; TCGA HNSC -0.132; TCGA LGG -0.12; TCGA LIHC -0.321; TCGA OV -0.105; TCGA PRAD -0.191; TCGA STAD -0.131
hsa-miR-532-5p
ITPRIPL2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; PRAD; THCA; UCEC
MirTarget
TCGA BLCA -0.226; TCGA BRCA -0.202; TCGA CESC -0.181; TCGA COAD -0.078; TCGA ESCA -0.121; TCGA HNSC -0.092; TCGA KIRC -0.156; TCGA LIHC -0.136; TCGA LUAD -0.139; TCGA PAAD -0.133; TCGA PRAD -0.145; TCGA THCA -0.308; TCGA UCEC -0.123
hsa-miR-532-5p
PCDHB10
15 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; OV; PAAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.166; TCGA CESC -0.206; TCGA COAD -0.316; TCGA ESCA -0.555; TCGA KIRC -0.7; TCGA KIRP -0.409; TCGA LGG -0.28; TCGA LIHC -0.32; TCGA LUAD -0.341; TCGA LUSC -0.177; TCGA OV -0.265; TCGA PAAD -0.254; TCGA THCA -0.309; TCGA STAD -0.324; TCGA UCEC -0.342
hsa-miR-532-5p
GBP1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; SARC
MirTarget; miRNATAP
TCGA BLCA -0.317; TCGA CESC -0.694; TCGA COAD -0.192; TCGA ESCA -0.359; TCGA HNSC -0.645; TCGA KIRC -0.513; TCGA LIHC -0.23; TCGA LUSC -0.378; TCGA PAAD -0.246; TCGA PRAD -0.228; TCGA SARC -0.201
hsa-miR-532-5p
RERG
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PRAD; SARC; STAD
MirTarget; PITA; miRNATAP
TCGA BLCA -0.445; TCGA BRCA -0.771; TCGA COAD -0.595; TCGA ESCA -0.302; TCGA KIRC -0.253; TCGA LIHC -0.438; TCGA PRAD -0.413; TCGA SARC -0.392; TCGA STAD -0.939
hsa-miR-532-5p
IRS2
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; OV; THCA; STAD; UCEC
MirTarget; PITA; miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.226; TCGA COAD -0.145; TCGA ESCA -0.394; TCGA KIRC -0.336; TCGA LIHC -0.2; TCGA LUAD -0.253; TCGA OV -0.177; TCGA THCA -0.127; TCGA STAD -0.465; TCGA UCEC -0.302
hsa-miR-532-5p
KCTD9
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC
MirTarget
TCGA BLCA -0.172; TCGA CESC -0.219; TCGA COAD -0.118; TCGA ESCA -0.161; TCGA HNSC -0.088; TCGA KIRC -0.082; TCGA LUAD -0.183; TCGA PAAD -0.16; TCGA PRAD -0.118; TCGA SARC -0.142
hsa-miR-532-5p
ARSJ
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.66; TCGA BRCA -0.185; TCGA COAD -0.427; TCGA ESCA -0.569; TCGA HNSC -0.635; TCGA LIHC -0.659; TCGA LUAD -0.149; TCGA LUSC -0.245; TCGA PAAD -0.372; TCGA PRAD -0.247; TCGA THCA -0.961; TCGA STAD -0.323
hsa-miR-532-5p
CYYR1
9 cancers: BLCA; COAD; KIRC; LIHC; LUAD; OV; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.172; TCGA COAD -0.369; TCGA KIRC -0.282; TCGA LIHC -0.147; TCGA LUAD -0.153; TCGA OV -0.217; TCGA PRAD -0.094; TCGA STAD -0.315; TCGA UCEC -0.153
hsa-miR-532-5p
NEGR1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; OV; PRAD; STAD
MirTarget; PITA
TCGA BLCA -0.966; TCGA BRCA -0.657; TCGA CESC -0.377; TCGA COAD -0.644; TCGA ESCA -0.396; TCGA LGG -0.183; TCGA LUAD -0.22; TCGA OV -0.439; TCGA PRAD -0.158; TCGA STAD -1.028
hsa-miR-532-5p
SFRP4
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; THCA; STAD
MirTarget
TCGA BLCA -0.931; TCGA BRCA -0.348; TCGA COAD -0.731; TCGA ESCA -1.136; TCGA KIRC -0.389; TCGA LIHC -0.272; TCGA LUAD -0.294; TCGA LUSC -0.384; TCGA THCA -0.423; TCGA STAD -0.599
hsa-miR-532-5p
APBB2
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUAD; OV; STAD
MirTarget; miRNATAP
TCGA BLCA -0.252; TCGA BRCA -0.41; TCGA COAD -0.12; TCGA HNSC -0.352; TCGA KIRC -0.174; TCGA LGG -0.171; TCGA LUAD -0.116; TCGA OV -0.089; TCGA STAD -0.096
hsa-miR-532-5p
PURA
10 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; OV; PRAD; STAD; UCEC
MirTarget; PITA
TCGA BLCA -0.116; TCGA BRCA -0.154; TCGA COAD -0.094; TCGA HNSC -0.077; TCGA LIHC -0.132; TCGA LUAD -0.085; TCGA OV -0.062; TCGA PRAD -0.109; TCGA STAD -0.13; TCGA UCEC -0.07
hsa-miR-532-5p
PDE5A
10 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD
MirTarget
TCGA BLCA -0.41; TCGA BRCA -0.2; TCGA COAD -0.532; TCGA KIRC -0.22; TCGA LIHC -0.429; TCGA LUAD -0.119; TCGA PRAD -0.414; TCGA SARC -0.575; TCGA THCA -0.913; TCGA STAD -0.45
hsa-miR-532-5p
PTEN
9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; OV; STAD
PITA; mirMAP; miRNATAP
TCGA BLCA -0.144; TCGA BRCA -0.207; TCGA CESC -0.209; TCGA COAD -0.086; TCGA ESCA -0.137; TCGA HNSC -0.203; TCGA LUAD -0.087; TCGA OV -0.11; TCGA STAD -0.088
hsa-miR-532-5p
ATXN1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
PITA
TCGA BLCA -0.445; TCGA BRCA -0.134; TCGA COAD -0.198; TCGA ESCA -0.283; TCGA HNSC -0.175; TCGA KIRC -0.221; TCGA KIRP -0.083; TCGA LUSC -0.103; TCGA PAAD -0.172; TCGA PRAD -0.171; TCGA STAD -0.302; TCGA UCEC -0.086
hsa-miR-532-5p
PCSK1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.496; TCGA CESC -0.758; TCGA COAD -0.609; TCGA ESCA -0.688; TCGA HNSC -0.281; TCGA KIRC -0.424; TCGA LUAD -0.654; TCGA LUSC -0.41; TCGA PRAD -0.443; TCGA SARC -0.6; TCGA STAD -0.812; TCGA UCEC -0.28
hsa-miR-532-5p
TWIST1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; OV; PAAD; STAD
PITA
TCGA BLCA -0.47; TCGA CESC -0.328; TCGA COAD -0.55; TCGA ESCA -0.802; TCGA HNSC -0.294; TCGA KIRC -0.632; TCGA LIHC -0.313; TCGA LUAD -0.396; TCGA LUSC -0.866; TCGA OV -0.221; TCGA PAAD -1.067; TCGA STAD -0.433
hsa-miR-532-5p
CACNA1C
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD; UCEC
PITA
TCGA BLCA -0.517; TCGA BRCA -0.337; TCGA COAD -0.54; TCGA ESCA -0.225; TCGA KIRC -0.54; TCGA LGG -0.107; TCGA LIHC -0.224; TCGA LUSC -0.207; TCGA OV -0.207; TCGA PRAD -0.359; TCGA SARC -0.704; TCGA STAD -0.697; TCGA UCEC -0.286
hsa-miR-532-5p
PDLIM5
12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.323; TCGA BRCA -0.136; TCGA COAD -0.144; TCGA HNSC -0.148; TCGA LGG -0.111; TCGA LIHC -0.369; TCGA LUAD -0.089; TCGA LUSC -0.093; TCGA PAAD -0.13; TCGA SARC -0.501; TCGA STAD -0.126; TCGA UCEC -0.097
hsa-miR-532-5p
MAF
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
PITA
TCGA BLCA -0.46; TCGA CESC -0.482; TCGA COAD -0.355; TCGA ESCA -0.892; TCGA HNSC -0.321; TCGA KIRC -0.363; TCGA LUAD -0.1; TCGA LUSC -0.21; TCGA PAAD -0.225; TCGA STAD -0.409
hsa-miR-532-5p
CAST
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA
TCGA BLCA -0.231; TCGA BRCA -0.14; TCGA CESC -0.257; TCGA ESCA -0.29; TCGA HNSC -0.198; TCGA LIHC -0.114; TCGA LUAD -0.094; TCGA LUSC -0.115; TCGA PAAD -0.142; TCGA PRAD -0.131; TCGA SARC -0.089; TCGA STAD -0.274; TCGA UCEC -0.073
hsa-miR-532-5p
BMPR2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; PRAD; THCA; STAD
PITA
TCGA BLCA -0.239; TCGA BRCA -0.195; TCGA COAD -0.153; TCGA ESCA -0.136; TCGA HNSC -0.166; TCGA LGG -0.073; TCGA LIHC -0.287; TCGA LUAD -0.169; TCGA PRAD -0.176; TCGA THCA -0.11; TCGA STAD -0.072
hsa-miR-532-5p
ITGB8
10 cancers: BLCA; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA
PITA
TCGA BLCA -0.252; TCGA ESCA -0.587; TCGA HNSC -0.191; TCGA KIRP -0.481; TCGA LIHC -1.185; TCGA LUAD -0.274; TCGA LUSC -0.265; TCGA PAAD -0.324; TCGA PRAD -0.651; TCGA THCA -0.925
hsa-miR-532-5p
POU2F2
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; LIHC; LUSC; PRAD; THCA; STAD; UCEC
PITA
TCGA BLCA -0.401; TCGA CESC -0.282; TCGA COAD -0.451; TCGA HNSC -0.205; TCGA KIRC -0.774; TCGA LIHC -0.353; TCGA LUSC -0.241; TCGA PRAD -0.239; TCGA THCA -0.393; TCGA STAD -0.304; TCGA UCEC -0.254
hsa-miR-532-5p
SNAI2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
PITA
TCGA BLCA -0.57; TCGA CESC -0.961; TCGA COAD -0.321; TCGA ESCA -1.323; TCGA HNSC -0.47; TCGA KIRC -0.191; TCGA LUAD -0.392; TCGA LUSC -0.305; TCGA PAAD -0.815; TCGA PRAD -0.342; TCGA STAD -0.297
hsa-miR-532-5p
COL12A1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA
PITA
TCGA BLCA -0.249; TCGA BRCA -0.338; TCGA CESC -0.575; TCGA COAD -0.352; TCGA ESCA -0.439; TCGA HNSC -0.66; TCGA KIRC -0.24; TCGA LIHC -0.492; TCGA LUAD -0.57; TCGA LUSC -0.719; TCGA PAAD -0.774; TCGA THCA -0.32
hsa-miR-532-5p
PLS3
9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; PAAD; PRAD; SARC; THCA
PITA; miRNATAP
TCGA BLCA -0.174; TCGA CESC -0.464; TCGA ESCA -0.609; TCGA HNSC -0.252; TCGA LUAD -0.211; TCGA PAAD -0.317; TCGA PRAD -0.311; TCGA SARC -0.203; TCGA THCA -0.162
hsa-miR-532-5p
MAP1B
10 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.57; TCGA COAD -0.567; TCGA ESCA -0.652; TCGA KIRC -0.434; TCGA LIHC -0.245; TCGA LUAD -0.37; TCGA PRAD -0.344; TCGA SARC -0.234; TCGA THCA -0.156; TCGA STAD -0.694
hsa-miR-532-5p
YAP1
9 cancers: BLCA; CESC; ESCA; HNSC; OV; PAAD; PRAD; SARC; THCA
PITA
TCGA BLCA -0.239; TCGA CESC -0.335; TCGA ESCA -0.164; TCGA HNSC -0.259; TCGA OV -0.077; TCGA PAAD -0.258; TCGA PRAD -0.145; TCGA SARC -0.331; TCGA THCA -0.122
hsa-miR-532-5p
EXOC5
9 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; STAD
PITA; miRNATAP
TCGA BLCA -0.099; TCGA COAD -0.058; TCGA ESCA -0.236; TCGA HNSC -0.104; TCGA LIHC -0.126; TCGA LUAD -0.099; TCGA PRAD -0.097; TCGA SARC -0.064; TCGA STAD -0.073
hsa-miR-532-5p
PRSS23
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.312; TCGA BRCA -0.55; TCGA CESC -0.367; TCGA HNSC -0.707; TCGA KIRC -0.57; TCGA LIHC -0.461; TCGA LUAD -0.266; TCGA LUSC -0.232; TCGA PAAD -0.338; TCGA PRAD -0.158; TCGA SARC -0.215; TCGA THCA -0.782; TCGA STAD -0.377
hsa-miR-532-5p
KLF12
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; OV; PRAD; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.515; TCGA COAD -0.472; TCGA ESCA -0.503; TCGA LGG -0.197; TCGA LUAD -0.134; TCGA OV -0.209; TCGA PRAD -0.151; TCGA THCA -0.366; TCGA STAD -0.427
hsa-miR-532-5p
SH3PXD2A
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; OV; PRAD; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.406; TCGA CESC -0.135; TCGA COAD -0.171; TCGA ESCA -0.322; TCGA HNSC -0.165; TCGA KIRC -0.468; TCGA LUSC -0.304; TCGA OV -0.142; TCGA PRAD -0.319; TCGA THCA -0.175; TCGA STAD -0.245
hsa-miR-532-5p
NUAK1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; OV; PAAD; PRAD; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.323; TCGA BRCA -0.283; TCGA COAD -0.346; TCGA ESCA -0.431; TCGA HNSC -0.256; TCGA KIRC -0.219; TCGA LUAD -0.338; TCGA LUSC -0.489; TCGA OV -0.21; TCGA PAAD -0.417; TCGA PRAD -0.328; TCGA STAD -0.153; TCGA UCEC -0.151
hsa-miR-532-5p
SULF1
15 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; UCEC
PITA; miRNATAP
TCGA BLCA -0.68; TCGA COAD -0.601; TCGA ESCA -0.527; TCGA HNSC -0.261; TCGA KIRC -0.904; TCGA KIRP -0.466; TCGA LIHC -0.536; TCGA LUAD -0.438; TCGA LUSC -0.584; TCGA OV -0.229; TCGA PAAD -0.841; TCGA PRAD -0.184; TCGA SARC -0.45; TCGA THCA -0.355; TCGA UCEC -0.168
hsa-miR-532-5p
NBEA
9 cancers: BLCA; BRCA; COAD; LGG; LIHC; PRAD; SARC; STAD; UCEC
PITA
TCGA BLCA -0.606; TCGA BRCA -0.751; TCGA COAD -1.007; TCGA LGG -0.158; TCGA LIHC -0.418; TCGA PRAD -0.227; TCGA SARC -0.265; TCGA STAD -1.014; TCGA UCEC -0.19
hsa-miR-532-5p
BNC2
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.772; TCGA BRCA -0.283; TCGA COAD -0.723; TCGA ESCA -0.954; TCGA KIRC -0.21; TCGA LIHC -0.408; TCGA LUAD -0.265; TCGA LUSC -0.387; TCGA OV -0.207; TCGA PAAD -0.456; TCGA PRAD -0.391; TCGA THCA -0.51; TCGA STAD -0.8; TCGA UCEC -0.35
hsa-miR-532-5p
ZNF608
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; PRAD; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.196; TCGA BRCA -0.265; TCGA HNSC -0.244; TCGA KIRC -0.52; TCGA KIRP -0.297; TCGA LGG -0.15; TCGA PRAD -0.203; TCGA THCA -0.328; TCGA STAD -0.149
hsa-miR-532-5p
PLXNA4
11 cancers: BLCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.546; TCGA COAD -0.632; TCGA ESCA -0.584; TCGA HNSC -0.244; TCGA LIHC -0.701; TCGA LUAD -0.249; TCGA LUSC -0.239; TCGA PRAD -0.389; TCGA SARC -0.713; TCGA THCA -0.428; TCGA STAD -0.679
hsa-miR-532-5p
TEAD1
10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; PRAD; SARC; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.238; TCGA BRCA -0.137; TCGA COAD -0.129; TCGA ESCA -0.108; TCGA LIHC -0.223; TCGA LUAD -0.187; TCGA PRAD -0.268; TCGA SARC -0.164; TCGA THCA -0.222; TCGA STAD -0.376
hsa-miR-532-5p
PCDH20
9 cancers: BLCA; BRCA; ESCA; LGG; OV; PRAD; SARC; THCA; STAD
PITA
TCGA BLCA -0.879; TCGA BRCA -0.657; TCGA ESCA -0.525; TCGA LGG -0.465; TCGA OV -0.395; TCGA PRAD -0.403; TCGA SARC -0.903; TCGA THCA -1.003; TCGA STAD -1.182
hsa-miR-532-5p
NKD1
11 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD
PITA; miRNATAP
TCGA BLCA -0.414; TCGA BRCA -0.122; TCGA ESCA -0.47; TCGA HNSC -0.242; TCGA LGG -0.253; TCGA LUSC -0.255; TCGA PAAD -0.567; TCGA PRAD -0.314; TCGA SARC -0.586; TCGA THCA -0.404; TCGA STAD -0.342
hsa-miR-532-5p
SYT11
11 cancers: BLCA; COAD; KIRC; LGG; LIHC; LUAD; OV; PRAD; SARC; THCA; STAD
PITA
TCGA BLCA -0.418; TCGA COAD -0.497; TCGA KIRC -0.131; TCGA LGG -0.095; TCGA LIHC -0.272; TCGA LUAD -0.177; TCGA OV -0.195; TCGA PRAD -0.148; TCGA SARC -0.315; TCGA THCA -0.456; TCGA STAD -0.477
hsa-miR-532-5p
COL24A1
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; THCA; STAD
PITA
TCGA BLCA -0.183; TCGA BRCA -0.205; TCGA COAD -0.629; TCGA ESCA -0.879; TCGA HNSC -0.281; TCGA LUSC -0.38; TCGA PAAD -0.553; TCGA THCA -0.26; TCGA STAD -0.442
hsa-miR-532-5p
RASSF5
9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; PRAD; THCA; UCEC
PITA; miRNATAP
TCGA BLCA -0.104; TCGA CESC -0.344; TCGA COAD -0.325; TCGA ESCA -0.28; TCGA KIRC -0.543; TCGA LIHC -0.217; TCGA PRAD -0.277; TCGA THCA -0.217; TCGA UCEC -0.16
hsa-miR-532-5p
IDS
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.136; TCGA BRCA -0.15; TCGA COAD -0.098; TCGA ESCA -0.231; TCGA HNSC -0.138; TCGA KIRC -0.239; TCGA LIHC -0.206; TCGA LUAD -0.097; TCGA PRAD -0.101; TCGA SARC -0.118; TCGA THCA -0.232; TCGA STAD -0.211
hsa-miR-532-5p
AGPAT4
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.352; TCGA CESC -0.347; TCGA COAD -0.612; TCGA ESCA -0.342; TCGA HNSC -0.375; TCGA KIRP -0.134; TCGA LGG -0.136; TCGA PAAD -0.393; TCGA PRAD -0.289; TCGA STAD -0.337
hsa-miR-532-5p
NFATC4
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.147; TCGA BRCA -0.351; TCGA COAD -0.262; TCGA ESCA -0.175; TCGA KIRC -0.405; TCGA KIRP -0.425; TCGA PAAD -0.24; TCGA PRAD -0.188; TCGA SARC -0.234; TCGA THCA -0.17; TCGA STAD -0.612; TCGA UCEC -0.111
hsa-miR-532-5p
BBX
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.194; TCGA BRCA -0.109; TCGA COAD -0.122; TCGA ESCA -0.131; TCGA HNSC -0.137; TCGA LIHC -0.149; TCGA LUAD -0.091; TCGA PRAD -0.198; TCGA SARC -0.081; TCGA STAD -0.092
hsa-miR-532-5p
CHST3
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.211; TCGA CESC -0.368; TCGA COAD -0.51; TCGA ESCA -0.821; TCGA HNSC -0.227; TCGA KIRC -0.131; TCGA KIRP -0.161; TCGA LIHC -0.234; TCGA LUAD -0.36; TCGA LUSC -0.23; TCGA PAAD -0.35; TCGA PRAD -0.342; TCGA STAD -0.516
hsa-miR-532-5p
NTRK3
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; OV; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.501; TCGA BRCA -0.218; TCGA COAD -0.706; TCGA ESCA -0.482; TCGA LGG -0.115; TCGA OV -0.382; TCGA PRAD -0.248; TCGA SARC -0.437; TCGA THCA -0.79; TCGA STAD -1.104
hsa-miR-532-5p
FTO
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.157; TCGA BRCA -0.181; TCGA COAD -0.115; TCGA ESCA -0.314; TCGA HNSC -0.187; TCGA KIRC -0.205; TCGA LIHC -0.153; TCGA LUAD -0.082; TCGA OV -0.094; TCGA PRAD -0.157; TCGA STAD -0.166; TCGA UCEC -0.074
hsa-miR-532-5p
DST
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.391; TCGA BRCA -0.184; TCGA CESC -0.745; TCGA COAD -0.287; TCGA ESCA -0.634; TCGA HNSC -0.296; TCGA LIHC -0.182; TCGA LUSC -0.217; TCGA PRAD -0.34; TCGA SARC -0.137; TCGA THCA -0.415; TCGA STAD -0.548
hsa-miR-532-5p
PTPN14
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; OV; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.154; TCGA CESC -0.185; TCGA COAD -0.244; TCGA ESCA -0.494; TCGA HNSC -0.244; TCGA KIRP -0.176; TCGA OV -0.097; TCGA PAAD -0.348; TCGA PRAD -0.272; TCGA SARC -0.213; TCGA THCA -0.288; TCGA STAD -0.212
hsa-miR-532-5p
MR1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.188; TCGA BRCA -0.203; TCGA CESC -0.328; TCGA COAD -0.137; TCGA ESCA -0.391; TCGA HNSC -0.239; TCGA LUSC -0.166; TCGA PRAD -0.326; TCGA SARC -0.094; TCGA STAD -0.157
hsa-miR-532-5p
KCTD15
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; PAAD; SARC; STAD
mirMAP
TCGA BLCA -0.535; TCGA CESC -0.386; TCGA COAD -0.418; TCGA ESCA -0.849; TCGA HNSC -0.115; TCGA KIRC -0.362; TCGA LGG -0.093; TCGA LIHC -0.311; TCGA LUAD -0.257; TCGA PAAD -0.305; TCGA SARC -0.24; TCGA STAD -0.481
hsa-miR-532-5p
FBXO32
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.432; TCGA CESC -0.3; TCGA COAD -0.483; TCGA ESCA -0.591; TCGA HNSC -0.191; TCGA LUAD -0.262; TCGA LUSC -0.454; TCGA PAAD -0.42; TCGA PRAD -0.309; TCGA SARC -0.725; TCGA STAD -0.795; TCGA UCEC -0.26
hsa-miR-532-5p
TSPAN18
9 cancers: BLCA; COAD; KIRC; LUAD; OV; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.475; TCGA COAD -0.4; TCGA KIRC -0.563; TCGA LUAD -0.197; TCGA OV -0.285; TCGA PAAD -0.238; TCGA PRAD -0.344; TCGA STAD -0.495; TCGA UCEC -0.191
hsa-miR-532-5p
NFASC
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.484; TCGA CESC -0.496; TCGA COAD -0.275; TCGA ESCA -0.835; TCGA HNSC -0.24; TCGA LIHC -0.309; TCGA PRAD -0.209; TCGA SARC -0.919; TCGA STAD -0.934
hsa-miR-532-5p
SLFN5
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PRAD; THCA
mirMAP
TCGA BLCA -0.291; TCGA CESC -0.188; TCGA COAD -0.412; TCGA ESCA -0.294; TCGA HNSC -0.32; TCGA KIRC -0.248; TCGA KIRP -0.304; TCGA LIHC -0.467; TCGA LUAD -0.123; TCGA PRAD -0.277; TCGA THCA -0.235
hsa-miR-532-5p
KCND3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -1.038; TCGA BRCA -1.099; TCGA COAD -0.917; TCGA ESCA -0.502; TCGA HNSC -0.435; TCGA LGG -0.171; TCGA LIHC -1.094; TCGA SARC -0.924; TCGA STAD -0.595; TCGA UCEC -0.508
hsa-miR-532-5p
SYNPO
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.449; TCGA CESC -0.642; TCGA COAD -0.314; TCGA ESCA -0.436; TCGA HNSC -0.362; TCGA KIRC -0.731; TCGA LIHC -0.266; TCGA LUAD -0.142; TCGA LUSC -0.288; TCGA PRAD -0.148; TCGA SARC -0.283; TCGA THCA -0.411; TCGA STAD -0.378; TCGA UCEC -0.272
hsa-miR-532-5p
POU6F1
9 cancers: BLCA; COAD; ESCA; KIRC; LGG; LIHC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.223; TCGA COAD -0.331; TCGA ESCA -0.202; TCGA KIRC -0.094; TCGA LGG -0.169; TCGA LIHC -0.101; TCGA SARC -0.194; TCGA STAD -0.618; TCGA UCEC -0.151
hsa-miR-532-5p
THSD4
9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LIHC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.371; TCGA BRCA -1.123; TCGA ESCA -0.512; TCGA HNSC -0.273; TCGA LGG -0.141; TCGA LIHC -0.451; TCGA PRAD -0.349; TCGA SARC -0.534; TCGA STAD -0.606
hsa-miR-532-5p
NEURL1B
11 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.205; TCGA CESC -0.19; TCGA ESCA -0.312; TCGA KIRC -0.588; TCGA LGG -0.121; TCGA LUAD -0.24; TCGA LUSC -0.202; TCGA PRAD -0.23; TCGA SARC -0.233; TCGA THCA -0.264; TCGA STAD -0.368
hsa-miR-532-5p
KIAA0040
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.186; TCGA BRCA -0.5; TCGA CESC -0.2; TCGA COAD -0.199; TCGA HNSC -0.157; TCGA LIHC -0.343; TCGA LUAD -0.136; TCGA PRAD -0.155; TCGA THCA -0.14; TCGA STAD -0.074
hsa-miR-532-5p
SPIRE1
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LIHC; PRAD; STAD
miRNATAP
TCGA BLCA -0.187; TCGA COAD -0.2; TCGA ESCA -0.501; TCGA HNSC -0.219; TCGA KIRC -0.082; TCGA LGG -0.073; TCGA LIHC -0.368; TCGA PRAD -0.073; TCGA STAD -0.388
hsa-miR-532-5p
MCTP1
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.559; TCGA CESC -0.382; TCGA COAD -0.586; TCGA ESCA -0.331; TCGA HNSC -0.457; TCGA KIRC -0.247; TCGA THCA -0.206; TCGA STAD -0.208; TCGA UCEC -0.398
hsa-miR-532-5p
IGF1R
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.306; TCGA BRCA -0.573; TCGA CESC -0.272; TCGA ESCA -0.649; TCGA HNSC -0.2; TCGA LGG -0.125; TCGA LIHC -0.594; TCGA LUAD -0.148; TCGA LUSC -0.156; TCGA OV -0.276; TCGA PAAD -0.297; TCGA PRAD -0.129; TCGA SARC -0.237; TCGA THCA -0.305; TCGA STAD -0.193
hsa-miR-532-5p
ANTXR2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; THCA; STAD
miRNATAP
TCGA BLCA -0.677; TCGA BRCA -0.083; TCGA COAD -0.417; TCGA HNSC -0.465; TCGA KIRC -0.219; TCGA LIHC -0.391; TCGA LUAD -0.189; TCGA LUSC -0.234; TCGA PAAD -0.237; TCGA THCA -0.119; TCGA STAD -0.683
hsa-miR-532-5p
DCLK1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; OV; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.529; TCGA BRCA -0.669; TCGA COAD -0.77; TCGA ESCA -1; TCGA KIRC -0.677; TCGA LIHC -0.272; TCGA OV -0.24; TCGA PRAD -0.47; TCGA THCA -0.316; TCGA STAD -0.99
hsa-miR-532-5p
NOX4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA; UCEC
miRNATAP
TCGA BLCA -0.342; TCGA BRCA -0.17; TCGA CESC -0.238; TCGA COAD -0.568; TCGA ESCA -0.449; TCGA HNSC -0.203; TCGA LUAD -0.477; TCGA LUSC -0.698; TCGA PAAD -0.926; TCGA THCA -0.742; TCGA UCEC -0.141
hsa-miR-532-5p
ARPP19
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.183; TCGA CESC -0.103; TCGA COAD -0.103; TCGA ESCA -0.133; TCGA LGG -0.058; TCGA LUAD -0.149; TCGA PRAD -0.108; TCGA SARC -0.211; TCGA STAD -0.062
hsa-miR-532-5p
SSPN
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.48; TCGA BRCA -0.192; TCGA CESC -0.205; TCGA COAD -0.456; TCGA ESCA -0.621; TCGA HNSC -0.398; TCGA KIRC -0.517; TCGA LIHC -0.582; TCGA LUAD -0.273; TCGA LUSC -0.439; TCGA PAAD -0.23; TCGA PRAD -0.36; TCGA SARC -0.185; TCGA THCA -0.287; TCGA STAD -0.715; TCGA UCEC -0.256
hsa-miR-532-5p
IGFBP5
9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.599; TCGA COAD -0.587; TCGA ESCA -0.456; TCGA LIHC -0.441; TCGA LUAD -0.363; TCGA LUSC -0.317; TCGA PRAD -0.134; TCGA THCA -0.89; TCGA STAD -0.66
hsa-miR-532-5p
GFRA1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; OV; STAD; UCEC
miRNATAP
TCGA BLCA -0.538; TCGA BRCA -1.415; TCGA COAD -0.826; TCGA ESCA -0.496; TCGA KIRC -0.268; TCGA LGG -0.418; TCGA OV -0.525; TCGA STAD -1.16; TCGA UCEC -0.307
hsa-miR-532-5p
GFPT2
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.728; TCGA CESC -0.939; TCGA COAD -0.776; TCGA ESCA -1.134; TCGA HNSC -0.42; TCGA KIRC -0.418; TCGA LIHC -0.71; TCGA LUAD -0.38; TCGA LUSC -0.536; TCGA PAAD -0.485; TCGA PRAD -0.16; TCGA STAD -0.626; TCGA UCEC -0.377
hsa-miR-532-5p
CCDC88A
9 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; PAAD; PRAD; STAD
miRNATAP
TCGA BLCA -0.344; TCGA CESC -0.214; TCGA COAD -0.517; TCGA ESCA -0.265; TCGA KIRC -0.302; TCGA LGG -0.082; TCGA PAAD -0.279; TCGA PRAD -0.181; TCGA STAD -0.168
hsa-miR-532-5p
PRICKLE1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; OV; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.573; TCGA CESC -0.306; TCGA COAD -0.55; TCGA ESCA -0.945; TCGA HNSC -0.46; TCGA KIRP -0.592; TCGA LIHC -0.716; TCGA OV -0.346; TCGA PAAD -0.284; TCGA PRAD -0.261; TCGA THCA -0.67; TCGA STAD -0.606
hsa-miR-532-5p
ITGB4
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.256; TCGA CESC -0.568; TCGA COAD -0.145; TCGA ESCA -0.392; TCGA HNSC -0.527; TCGA KIRC -0.499; TCGA KIRP -0.7; TCGA LIHC -0.167; TCGA LUAD -0.229; TCGA LUSC -0.522; TCGA PAAD -0.716; TCGA PRAD -0.498; TCGA SARC -0.351; TCGA THCA -0.814; TCGA UCEC -0.532
hsa-miR-532-5p
RHBDD1
10 cancers: BLCA; BRCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.15; TCGA HNSC -0.119; TCGA LIHC -0.087; TCGA LUAD -0.056; TCGA LUSC -0.105; TCGA PRAD -0.158; TCGA SARC -0.143; TCGA STAD -0.095; TCGA UCEC -0.07
hsa-miR-532-5p
ITGA11
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; UCEC
miRNATAP
TCGA BLCA -0.442; TCGA BRCA -0.223; TCGA COAD -0.411; TCGA ESCA -0.358; TCGA HNSC -0.431; TCGA KIRC -0.239; TCGA LIHC -0.314; TCGA LUAD -0.488; TCGA LUSC -0.927; TCGA PAAD -1.127; TCGA UCEC -0.385
hsa-miR-532-5p
KCNMA1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LIHC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.651; TCGA BRCA -0.603; TCGA COAD -1.011; TCGA ESCA -1.457; TCGA KIRC -0.581; TCGA LIHC -0.459; TCGA PRAD -0.368; TCGA SARC -0.878; TCGA STAD -1.363; TCGA UCEC -0.211
hsa-miR-532-5p
FAM63B
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; OV; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.153; TCGA BRCA -0.313; TCGA COAD -0.247; TCGA ESCA -0.155; TCGA HNSC -0.214; TCGA LIHC -0.364; TCGA OV -0.114; TCGA PAAD -0.283; TCGA PRAD -0.149; TCGA SARC -0.224; TCGA STAD -0.189; TCGA UCEC -0.136
hsa-miR-532-5p
NRP2
14 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.564; TCGA COAD -0.472; TCGA ESCA -0.705; TCGA HNSC -0.258; TCGA KIRC -0.739; TCGA LIHC -0.347; TCGA LUAD -0.286; TCGA LUSC -0.233; TCGA PAAD -0.527; TCGA PRAD -0.286; TCGA SARC -0.229; TCGA THCA -0.723; TCGA STAD -0.65; TCGA UCEC -0.17
hsa-miR-532-5p
FBXL2
9 cancers: BRCA; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; STAD
MirTarget; miRNATAP
TCGA BRCA -0.165; TCGA COAD -0.459; TCGA ESCA -0.325; TCGA HNSC -0.327; TCGA LIHC -0.241; TCGA LUSC -0.153; TCGA PAAD -0.369; TCGA PRAD -0.323; TCGA STAD -0.464
hsa-miR-532-5p
BHLHE41
13 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.196; TCGA COAD -0.332; TCGA ESCA -0.261; TCGA HNSC -0.282; TCGA KIRC -1.044; TCGA KIRP -0.282; TCGA LIHC -0.454; TCGA LUSC -0.325; TCGA PAAD -0.374; TCGA PRAD -0.327; TCGA THCA -0.426; TCGA STAD -0.296; TCGA UCEC -0.307
hsa-miR-532-5p
GATA3
9 cancers: BRCA; CESC; COAD; HNSC; LIHC; PAAD; PRAD; THCA; UCEC
PITA; miRNATAP
TCGA BRCA -1.122; TCGA CESC -0.536; TCGA COAD -0.437; TCGA HNSC -0.276; TCGA LIHC -0.548; TCGA PAAD -0.714; TCGA PRAD -0.758; TCGA THCA -0.569; TCGA UCEC -0.373
hsa-miR-532-5p
GRIK3
9 cancers: BRCA; COAD; ESCA; KIRC; LGG; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -1.117; TCGA COAD -0.361; TCGA ESCA -0.857; TCGA KIRC -1.93; TCGA LGG -0.345; TCGA PRAD -0.284; TCGA THCA -0.669; TCGA STAD -1.212; TCGA UCEC -0.324
hsa-miR-532-5p
TMEM154
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; STAD
mirMAP
TCGA BRCA -0.088; TCGA CESC -0.602; TCGA ESCA -0.88; TCGA HNSC -0.361; TCGA KIRC -0.245; TCGA KIRP -0.297; TCGA LIHC -0.609; TCGA PAAD -0.329; TCGA PRAD -0.521; TCGA THCA -0.668; TCGA STAD -0.278
hsa-miR-532-5p
ZNF827
9 cancers: BRCA; HNSC; LGG; LIHC; LUSC; OV; PRAD; STAD; UCEC
miRNATAP
TCGA BRCA -0.259; TCGA HNSC -0.203; TCGA LGG -0.171; TCGA LIHC -0.538; TCGA LUSC -0.116; TCGA OV -0.09; TCGA PRAD -0.258; TCGA STAD -0.165; TCGA UCEC -0.142
hsa-miR-532-5p
EPN2
11 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; OV; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.075; TCGA COAD -0.201; TCGA ESCA -0.411; TCGA KIRC -0.156; TCGA KIRP -0.263; TCGA LGG -0.189; TCGA OV -0.077; TCGA SARC -0.187; TCGA THCA -0.155; TCGA STAD -0.239; TCGA UCEC -0.118
hsa-miR-532-5p
KDM5B
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA
miRNATAP
TCGA BRCA -0.066; TCGA COAD -0.169; TCGA ESCA -0.306; TCGA HNSC -0.24; TCGA KIRC -0.098; TCGA KIRP -0.18; TCGA LGG -0.14; TCGA LUAD -0.087; TCGA LUSC -0.157; TCGA PAAD -0.171; TCGA THCA -0.244
hsa-miR-532-5p
MDFIC
10 cancers: CESC; COAD; ESCA; KIRC; LIHC; LUAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.359; TCGA COAD -0.526; TCGA ESCA -0.614; TCGA KIRC -0.141; TCGA LIHC -0.255; TCGA LUAD -0.184; TCGA PRAD -0.368; TCGA THCA -0.316; TCGA STAD -0.417; TCGA UCEC -0.231
hsa-miR-532-5p
CCBE1
9 cancers: CESC; COAD; ESCA; HNSC; LIHC; LUAD; PRAD; STAD; UCEC
MirTarget
TCGA CESC -0.659; TCGA COAD -1.152; TCGA ESCA -0.561; TCGA HNSC -0.769; TCGA LIHC -1.109; TCGA LUAD -0.239; TCGA PRAD -0.598; TCGA STAD -0.559; TCGA UCEC -0.295
hsa-miR-532-5p
EFNB2
9 cancers: CESC; HNSC; KIRC; KIRP; LIHC; LUAD; OV; PAAD; THCA
PITA
TCGA CESC -0.192; TCGA HNSC -0.414; TCGA KIRC -0.405; TCGA KIRP -0.556; TCGA LIHC -0.185; TCGA LUAD -0.279; TCGA OV -0.172; TCGA PAAD -0.209; TCGA THCA -0.148
hsa-miR-532-5p
EREG
9 cancers: CESC; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; THCA
mirMAP
TCGA CESC -0.651; TCGA ESCA -0.776; TCGA HNSC -0.845; TCGA KIRP -1.261; TCGA LIHC -0.38; TCGA LUAD -0.536; TCGA LUSC -0.441; TCGA PAAD -1.204; TCGA THCA -1.36
hsa-miR-532-5p
MAP2
9 cancers: COAD; ESCA; HNSC; KIRC; LGG; LUAD; OV; THCA; STAD
PITA
TCGA COAD -0.664; TCGA ESCA -0.642; TCGA HNSC -0.531; TCGA KIRC -0.432; TCGA LGG -0.373; TCGA LUAD -0.183; TCGA OV -0.272; TCGA THCA -0.443; TCGA STAD -0.605
hsa-miR-532-5p
SERTAD2
10 cancers: COAD; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD
PITA; mirMAP
TCGA COAD -0.092; TCGA ESCA -0.456; TCGA KIRC -0.229; TCGA KIRP -0.135; TCGA LUAD -0.081; TCGA PAAD -0.248; TCGA PRAD -0.105; TCGA SARC -0.08; TCGA THCA -0.245; TCGA STAD -0.172





Enriched cancer pathways of putative targets