microRNA information: hsa-miR-539-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-539-5p | miRbase |
Accession: | MIMAT0003163 | miRbase |
Precursor name: | hsa-mir-539 | miRbase |
Precursor accession: | MI0003514 | miRbase |
Symbol: | MIR539 | HGNC |
RefSeq ID: | NR_030256 | GenBank |
Sequence: | GGAGAAAUUAUCCUUGGUGUGU |
Reported expression in cancers: hsa-miR-539-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-539-5p | sarcoma | downregulation | "The expression levels of miR-133a and miR-539 were ......" | 26388701 | qPCR |
Reported cancer pathway affected by hsa-miR-539-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-539-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-539-5p | colon cancer | staging | "We assessed by qRT-PCR expression of 754 microRNAs ......" | 27485175 | |
hsa-miR-539-5p | prostate cancer | progression; metastasis | "miR 539 inhibits prostate cancer progression by di ......" | 27037000 | Luciferase |
hsa-miR-539-5p | sarcoma | tumorigenesis | "MicroRNA 539 suppresses osteosarcoma cell invasion ......" | 26339374 | Luciferase |
hsa-miR-539-5p | sarcoma | worse prognosis; staging; metastasis; recurrence; poor survival; progression | "Down regulation of miR 133a and miR 539 are associ ......" | 26388701 | |
hsa-miR-539-5p | thyroid cancer | cell migration | "MiR 539 inhibits thyroid cancer cell migration and ......" | 26206083 | Luciferase |
Reported gene related to hsa-miR-539-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-539-5p | thyroid cancer | CARD11 | "MiR 539 inhibits thyroid cancer cell migration and ......" | 26206083 |
hsa-miR-539-5p | sarcoma | MMP8 | "We also identified that MMP8 was a direct target o ......" | 26339374 |
hsa-miR-539-5p | prostate cancer | SPAG5 | "miR 539 inhibits prostate cancer progression by di ......" | 27037000 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-539-5p | ZNF862 | 9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LIHC; LUSC; OV; STAD | mirMAP | TCGA BLCA -0.111; TCGA BRCA -0.094; TCGA ESCA -0.129; TCGA KIRC -0.096; TCGA LGG -0.091; TCGA LIHC -0.088; TCGA LUSC -0.098; TCGA OV -0.125; TCGA STAD -0.098 |
hsa-miR-539-5p | TP53INP1 | 9 cancers: BLCA; COAD; HNSC; KIRC; LGG; LUSC; OV; SARC; STAD | mirMAP | TCGA BLCA -0.079; TCGA COAD -0.125; TCGA HNSC -0.054; TCGA KIRC -0.082; TCGA LGG -0.146; TCGA LUSC -0.067; TCGA OV -0.06; TCGA SARC -0.079; TCGA STAD -0.111 |
hsa-miR-539-5p | NRBP2 | 10 cancers: BLCA; BRCA; CESC; KIRC; LIHC; LUSC; OV; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.073; TCGA BRCA -0.085; TCGA CESC -0.107; TCGA KIRC -0.185; TCGA LIHC -0.091; TCGA LUSC -0.075; TCGA OV -0.135; TCGA PAAD -0.106; TCGA SARC -0.143; TCGA STAD -0.127 |
Enriched cancer pathways of putative targets