microRNA information: hsa-miR-541-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-541-3p | miRbase |
Accession: | MIMAT0004920 | miRbase |
Precursor name: | hsa-mir-541 | miRbase |
Precursor accession: | MI0005539 | miRbase |
Symbol: | MIR541 | HGNC |
RefSeq ID: | NR_030594 | GenBank |
Sequence: | UGGUGGGCACAGAAUCUGGACU |
Reported expression in cancers: hsa-miR-541-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-541-3p | lung squamous cell cancer | downregulation | "Herein we demonstrated that miR-541-3p is a tumor- ......" | 27448300 |
Reported cancer pathway affected by hsa-miR-541-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-541-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-541-3p | lung squamous cell cancer | progression; staging; poor survival; metastasis | "MiR 541 3p reverses cancer progression by directly ......" | 27448300 |
Reported gene related to hsa-miR-541-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-541-3p | lung squamous cell cancer | TGIF2 | "MiR 541 3p reverses cancer progression by directly ......" | 27448300 |