microRNA information: hsa-miR-543
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-543 | miRbase |
| Accession: | MIMAT0004954 | miRbase |
| Precursor name: | hsa-mir-543 | miRbase |
| Precursor accession: | MI0005565 | miRbase |
| Symbol: | MIR543 | HGNC |
| RefSeq ID: | NR_030619 | GenBank |
| Sequence: | AAACAUUCGCGGUGCACUUCUU |
Reported expression in cancers: hsa-miR-543
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-543 | colorectal cancer | downregulation | "miR-543 has been implicated as having a critical r ......" | 26968810 | |
| hsa-miR-543 | colorectal cancer | upregulation | "Dysregulation of MicroRNA 543 expression in colore ......" | 27148794 |
Reported cancer pathway affected by hsa-miR-543
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-543 | gastric cancer | cell cycle pathway | "miR 543 promotes gastric cancer cell proliferation ......" | 26612257 |
Reported cancer prognosis affected by hsa-miR-543
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-543 | colorectal cancer | metastasis | "MicroRNA 543 suppresses colorectal cancer growth a ......" | 26968810 | |
| hsa-miR-543 | colorectal cancer | cell migration; metastasis | "Dysregulation of MicroRNA 543 expression in colore ......" | 27148794 | Luciferase |
| hsa-miR-543 | endometrial cancer | malignant trasformation | "MicroRNA 543 suppresses endometrial cancer oncogen ......" | 24699721 | |
| hsa-miR-543 | gastric cancer | progression; staging; metastasis; tumor size | "miR 543 promotes gastric cancer cell proliferation ......" | 26612257 | |
| hsa-miR-543 | liver cancer | tumorigenesis | "MicroRNA 543 acts as an oncogene by targeting PAQR ......" | 25520877 | Western blot |
| hsa-miR-543 | ovarian cancer | metastasis | "Placental growth factor promotes metastases of ova ......" | 26402225 | Luciferase |
Reported gene related to hsa-miR-543
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-543 | ovarian cancer | MMP7 | "Placental growth factor promotes metastases of ova ......" | 26402225 |
| hsa-miR-543 | liver cancer | PAQR3 | "MicroRNA 543 acts as an oncogene by targeting PAQR ......" | 25520877 |
| hsa-miR-543 | ovarian cancer | PGF | "Placental growth factor promotes metastases of ova ......" | 26402225 |
| hsa-miR-543 | colorectal cancer | PTEN | "Moreover we identified PTEN as a direct target of ......" | 27148794 |
| hsa-miR-543 | endometrial cancer | PTK2 | "MicroRNA 543 suppresses endometrial cancer oncogen ......" | 24699721 |
| hsa-miR-543 | gastric cancer | SIRT1 | "miR 543 promotes gastric cancer cell proliferation ......" | 26612257 |
| hsa-miR-543 | endometrial cancer | TWIST1 | "MicroRNA 543 suppresses endometrial cancer oncogen ......" | 24699721 |
Expression profile in cancer corhorts:
