microRNA information: hsa-miR-548a-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-548a-3p | miRbase |
Accession: | MIMAT0003251 | miRbase |
Precursor name: | hsa-mir-548a-1 | miRbase |
Precursor accession: | MI0003593 | miRbase |
Symbol: | MIR548A1 | HGNC |
RefSeq ID: | NR_030312 | GenBank |
Sequence: | CAAAACUGGCAAUUACUUUUGC |
Reported expression in cancers: hsa-miR-548a-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|
Reported cancer pathway affected by hsa-miR-548a-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-548a-3p | NA | NA | "NA ......" | NA | NA |
hsa-miR-548a-3p | " ......" |
Reported cancer prognosis affected by hsa-miR-548a-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-548a-3p | breast cancer | poor survival | "NEAT1 is Required for Survival of Breast Cancer Ce ......" | 27147820 |
Reported gene related to hsa-miR-548a-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-548a-3p | breast cancer | FUS | "NEAT1 is Required for Survival of Breast Cancer Ce ......" | 27147820 |
hsa-miR-548a-3p | pancreatic cancer | HDAC1 | "In addition inhibition of HDAC1 with trichostatin ......" | 27353169 |
hsa-miR-548a-3p | breast cancer | NEAT1 | "NEAT1 is Required for Survival of Breast Cancer Ce ......" | 27147820 |