microRNA information: hsa-miR-548c-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-548c-3p | miRbase |
| Accession: | MIMAT0003285 | miRbase |
| Precursor name: | hsa-mir-548c | miRbase |
| Precursor accession: | MI0003630 | miRbase |
| Symbol: | MIR548C | HGNC |
| RefSeq ID: | NR_030347 | GenBank |
| Sequence: | CAAAAAUCUCAAUUACUUUUGC |
Reported expression in cancers: hsa-miR-548c-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-548c-3p | ovarian cancer | downregulation | "We investigated the biological role and underlying ......" | 26762267 |
Reported cancer pathway affected by hsa-miR-548c-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-548c-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "Decreased Expression of miR 548c 3p in Osteosarcom ......" | 27310302 | Luciferase; Colony formation |
Reported cancer prognosis affected by hsa-miR-548c-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-548c-3p | breast cancer | drug resistance | "Microarray analysis was performed to identify the ......" | 25802200 | |
| hsa-miR-548c-3p | breast cancer | tumor size | "A combination of the tumoral expression of miR-548 ......" | 26490435 | |
| hsa-miR-548c-3p | ovarian cancer | worse prognosis; cell migration | "MiR 548c impairs migration and invasion of endomet ......" | 26762267 | Western blot; Luciferase |
| hsa-miR-548c-3p | prostate cancer | drug resistance; poor survival; recurrence; progression | "Microarray expression was validated in an independ ......" | 25234358 |
Reported gene related to hsa-miR-548c-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-548c-3p | ovarian cancer | TWIST1 | "MiR 548c impairs migration and invasion of endomet ......" | 26762267 |
| hsa-miR-548c-3p | prostate cancer | TWIST1 | "Overexpression of miR-548c-3p was confirmed in SCs ......" | 25234358 |
| hsa-miR-548c-3p | sarcoma | FBXW11 | "Thus the authors collected OS tissues n = 15 a ......" | 27310302 |
| hsa-miR-548c-3p | sarcoma | ITGA9 | "The results indicated that the miR-548c-3p similar ......" | 27310302 |
| hsa-miR-548c-3p | sarcoma | ITGAV | "Decreased Expression of miR 548c 3p in Osteosarcom ......" | 27310302 |