microRNA information: hsa-miR-548c-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-548c-5p | miRbase |
| Accession: | MIMAT0004806 | miRbase |
| Precursor name: | hsa-mir-548c | miRbase |
| Precursor accession: | MI0003630 | miRbase |
| Symbol: | MIR548C | HGNC |
| RefSeq ID: | NR_030347 | GenBank |
| Sequence: | AAAAGUAAUUGCGGUUUUUGCC |
Reported expression in cancers: hsa-miR-548c-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-548c-5p | ovarian cancer | downregulation | "We investigated the biological role and underlying ......" | 26762267 |
Reported cancer pathway affected by hsa-miR-548c-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-548c-5p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-548c-5p | " ......" |
Reported cancer prognosis affected by hsa-miR-548c-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-548c-5p | breast cancer | tumor size | "miR-548c-5p was emphasized as a new independent pr ......" | 26490435 | |
| hsa-miR-548c-5p | ovarian cancer | worse prognosis; cell migration | "MiR 548c impairs migration and invasion of endomet ......" | 26762267 | Western blot; Luciferase |
Reported gene related to hsa-miR-548c-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-548c-5p | sarcoma | ITGAV | "Decreased Expression of miR 548c 3p in Osteosarcom ......" | 27310302 |
| hsa-miR-548c-5p | ovarian cancer | TWIST1 | "MiR 548c impairs migration and invasion of endomet ......" | 26762267 |