microRNA information: hsa-miR-556-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-556-5p | miRbase |
| Accession: | MIMAT0003220 | miRbase |
| Precursor name: | hsa-mir-556 | miRbase |
| Precursor accession: | MI0003562 | miRbase |
| Symbol: | MIR556 | HGNC |
| RefSeq ID: | NR_030283 | GenBank |
| Sequence: | GAUGAGCUCAUUGUAAUAUGAG |
Reported expression in cancers: hsa-miR-556-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-556-5p | prostate cancer | upregulation | "Previous studies have shown that miR-556-5p have e ......" | 26297546 |
Reported cancer pathway affected by hsa-miR-556-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-556-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-556-5p | colorectal cancer | staging; poor survival | "Furthermore in a separate cohort of 50 consecutive ......" | 25788261 | |
| hsa-miR-556-5p | prostate cancer | tumorigenesis | "Upregulation of miR 556 5p promoted prostate cance ......" | 26297546 | Colony formation; MTT assay |
Reported gene related to hsa-miR-556-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-556-5p | prostate cancer | PPP2R2A | "Upregulation of miR 556 5p promoted prostate cance ......" | 26297546 |