microRNA information: hsa-miR-568
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-568 | miRbase |
| Accession: | MIMAT0003232 | miRbase |
| Precursor name: | hsa-mir-568 | miRbase |
| Precursor accession: | MI0003574 | miRbase |
| Symbol: | MIR568 | HGNC |
| RefSeq ID: | NR_030293 | GenBank |
| Sequence: | AUGUAUAAAUGUAUACACAC |
Reported expression in cancers: hsa-miR-568
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-568 | chronic myeloid leukemia | deregulation | "Some onco-miRNAs were found to be downregulated mi ......" | 25833191 |
Reported cancer pathway affected by hsa-miR-568
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-568
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-568 | breast cancer | metastasis | "Nuclear factor of activated T cells 5 maintained b ......" | 25311085 |
Reported gene related to hsa-miR-568
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-568 | breast cancer | HOTAIR | "Nuclear factor of activated T cells 5 maintained b ......" | 25311085 |