microRNA information: hsa-miR-574-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-574-3p | miRbase |
Accession: | MIMAT0003239 | miRbase |
Precursor name: | hsa-mir-574 | miRbase |
Precursor accession: | MI0003581 | miRbase |
Symbol: | MIR574 | HGNC |
RefSeq ID: | NR_030300 | GenBank |
Sequence: | CACGCUCAUGCACACACCCACA |
Reported expression in cancers: hsa-miR-574-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-574-3p | breast cancer | downregulation | "MicroRNA 574 3p identified by microRNA library bas ......" | 25560734 | |
hsa-miR-574-3p | breast cancer | upregulation | "The aim of this study was to investigate the role ......" | 27746365 | qPCR |
hsa-miR-574-3p | esophageal cancer | deregulation | "The expression profiles of miRNAs in paired EC and ......" | 23761828 | Microarray; qPCR |
hsa-miR-574-3p | gastric cancer | downregulation | "Aberrant expression of microRNAs in gastric cancer ......" | 22683180 | |
hsa-miR-574-3p | head and neck cancer | upregulation | "High expression of miR-142-3p miR-186-5p miR-195-5 ......" | 26057452 | |
hsa-miR-574-3p | prostate cancer | downregulation | "Genistein up regulates tumor suppressor microRNA 5 ......" | 23554959 | |
hsa-miR-574-3p | thyroid cancer | downregulation | "Interestingly miR-152-3p miR-185-5p and miR-574-3p ......" | 27586203 |
Reported cancer pathway affected by hsa-miR-574-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-574-3p | bladder cancer | Apoptosis pathway | "Novel oncogenic function of mesoderm development c ......" | 22179486 | Flow cytometry; Luciferase |
hsa-miR-574-3p | prostate cancer | Apoptosis pathway; Wnt signaling pathway; Jak-STAT signaling pathway | "Genistein up regulates tumor suppressor microRNA 5 ......" | 23554959 | Luciferase |
Reported cancer prognosis affected by hsa-miR-574-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-574-3p | breast cancer | drug resistance | "MicroRNA 574 3p identified by microRNA library bas ......" | 25560734 | Luciferase |
hsa-miR-574-3p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
hsa-miR-574-3p | colorectal cancer | metastasis | "Hsa miR 574 5p negatively regulates MACC 1 express ......" | 24936152 | Luciferase; Colony formation |
hsa-miR-574-3p | esophageal cancer | poor survival; progression | "The expression of microRNA 574 3p as a predictor o ......" | 27565418 | |
hsa-miR-574-3p | gastric cancer | staging; differentiation | "Aberrant expression of microRNAs in gastric cancer ......" | 22683180 | |
hsa-miR-574-3p | head and neck cancer | worse prognosis | "High expression of miR-142-3p miR-186-5p miR-195-5 ......" | 26057452 | |
hsa-miR-574-3p | lung cancer | progression | "MicroRNA 574 5p was pivotal for TLR9 signaling enh ......" | 23133627 | |
hsa-miR-574-3p | lung squamous cell cancer | staging | "miR 1254 and miR 574 5p: serum based microRNA biom ......" | 21258252 | |
hsa-miR-574-3p | lung squamous cell cancer | metastasis; worse prognosis | "Tumor invasion and metastasis regulated by microRN ......" | 26587830 | |
hsa-miR-574-3p | lung squamous cell cancer | metastasis | "MicroRNA 574 5p promotes metastasis of non small c ......" | 27761023 | |
hsa-miR-574-3p | prostate cancer | staging | "Genistein up regulates tumor suppressor microRNA 5 ......" | 23554959 | Luciferase |
Reported gene related to hsa-miR-574-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-574-3p | head and neck cancer | DICER1 | "Furthermore luciferase activity assay showed that ......" | 23071822 |
hsa-miR-574-3p | lung cancer | FOXN3 | "MicroRNA 574 5p was pivotal for TLR9 signaling enh ......" | 23133627 |
hsa-miR-574-3p | bladder cancer | MESDC1 | "Oligo microarray analysis suggested that the mesod ......" | 22179486 |
hsa-miR-574-3p | lung squamous cell cancer | PTPRU | "MicroRNA 574 5p promotes metastasis of non small c ......" | 27761023 |
hsa-miR-574-3p | lung cancer | TLR9 | "MicroRNA 574 5p was pivotal for TLR9 signaling enh ......" | 23133627 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-574-3p | TSNAX | 10 cancers: BLCA; COAD; KIRP; LUAD; LUSC; OV; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.062; TCGA COAD -0.085; TCGA KIRP -0.089; TCGA LUAD -0.093; TCGA LUSC -0.073; TCGA OV -0.072; TCGA PRAD -0.091; TCGA SARC -0.093; TCGA STAD -0.068; TCGA UCEC -0.142 |
Enriched cancer pathways of putative targets