microRNA information: hsa-miR-574-5p

SectionIDlink
Mature name: hsa-miR-574-5pmiRbase
Accession: MIMAT0004795miRbase
Precursor name: hsa-mir-574 miRbase
Precursor accession: MI0003581miRbase
Symbol: MIR574HGNC
RefSeq ID: NR_030300GenBank
Sequence: UGAGUGUGUGUGUGUGAGUGUGU



Reported expression in cancers: hsa-miR-574-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-574-5p

breast cancerupregulation"The aim of this study was to investigate the role ......"27746365qPCR
hsa-miR-574-5p

colorectal cancerupregulation"miR 574 5p negatively regulates Qki6/7 to impact ......"22490519
hsa-miR-574-5p

esophageal cancerderegulation"In this study differentially expressed miRNAs in t ......"23124769Microarray; Reverse transcription PCR; qPCR



Reported cancer pathway affected by hsa-miR-574-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-574-5p

bladder cancerApoptosis pathway"Novel oncogenic function of mesoderm development c ......"22179486Luciferase; Flow cytometry
hsa-miR-574-5p

cervical and endocervical cancercell cycle pathway"Nude mouse tumorigenicity assay was used to study ......"27049079Flow cytometry
hsa-miR-574-5p

colorectal cancercell cycle pathway"miR 574 5p negatively regulates Qki6/7 to impact ......"22490519
hsa-miR-574-5p

thyroid cancercell cycle pathway; Apoptosis pathway"Cell growth cell cycle transition and apoptosis we ......"23599737Flow cytometry; MTT assay



Reported cancer prognosis affected by hsa-miR-574-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-574-5p

breast cancerdrug resistance"MicroRNA 574 3p identified by microRNA library bas ......"25560734
hsa-miR-574-5p

breast cancerworse prognosis; drug resistance"The aim of this study was to investigate the role ......"27746365
hsa-miR-574-5p

cervical and endocervical cancermetastasis; poor survival; cell migration"Nude mouse tumorigenicity assay was used to study ......"27049079Flow cytometry
hsa-miR-574-5p

colorectal cancerprogression; differentiation"miR 574 5p negatively regulates Qki6/7 to impact ......"22490519
hsa-miR-574-5p

colorectal cancermetastasis"Hsa miR 574 5p negatively regulates MACC 1 express ......"24936152Western blot; Luciferase; Colony formation
hsa-miR-574-5p

lung cancerprogression"MicroRNA 574 5p was pivotal for TLR9 signaling enh ......"23133627
hsa-miR-574-5p

lung squamous cell cancerpoor survival; drug resistance"miRNA microarray profiling was performed on diagno ......"20548249
hsa-miR-574-5p

lung squamous cell cancerstaging"miR 1254 and miR 574 5p: serum based microRNA biom ......"21258252
hsa-miR-574-5p

lung squamous cell cancermetastasis; worse prognosis"Tumor invasion and metastasis regulated by microRN ......"26587830
hsa-miR-574-5p

lung squamous cell cancermetastasis; staging"MicroRNA 574 5p promotes metastasis of non small c ......"27761023Wound Healing Assay



Reported gene related to hsa-miR-574-5p

miRNAcancergenereportingPUBMED
hsa-miR-574-5p

cervical and endocervical cancerQKI"Cell wound scratch assay flow cytometry and real-t ......"27049079
hsa-miR-574-5p

colorectal cancerQKI"Expression of miR-574-5p Qki5/6/7/7b splicing vari ......"22490519
hsa-miR-574-5p

colorectal cancerCDKN1B"Expression of miR-574-5p Qki5/6/7/7b splicing vari ......"22490519
hsa-miR-574-5p

lung cancerFOXN3"MicroRNA 574 5p was pivotal for TLR9 signaling enh ......"23133627
hsa-miR-574-5p

cervical and endocervical cancerMIAT"The results demonstrated that cervical cancer tiss ......"27049079
hsa-miR-574-5p

thyroid cancerPTCSC3"The top 20 miRNAs to have a potential interaction ......"23599737
hsa-miR-574-5p

lung squamous cell cancerPTPRU"MicroRNA 574 5p promotes metastasis of non small c ......"27761023
hsa-miR-574-5p

lung squamous cell cancerSCLC1"We showed that miR-184 significantly attenuated th ......"26587830
hsa-miR-574-5p

lung cancerTLR9"MicroRNA 574 5p was pivotal for TLR9 signaling enh ......"23133627