microRNA information: hsa-miR-574-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-574-5p | miRbase |
| Accession: | MIMAT0004795 | miRbase |
| Precursor name: | hsa-mir-574 | miRbase |
| Precursor accession: | MI0003581 | miRbase |
| Symbol: | MIR574 | HGNC |
| RefSeq ID: | NR_030300 | GenBank |
| Sequence: | UGAGUGUGUGUGUGUGAGUGUGU |
Reported expression in cancers: hsa-miR-574-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-574-5p | breast cancer | upregulation | "The aim of this study was to investigate the role ......" | 27746365 | qPCR |
| hsa-miR-574-5p | colorectal cancer | upregulation | "miR 574 5p negatively regulates Qki6/7 to impact Î ......" | 22490519 | |
| hsa-miR-574-5p | esophageal cancer | deregulation | "In this study differentially expressed miRNAs in t ......" | 23124769 | Microarray; Reverse transcription PCR; qPCR |
Reported cancer pathway affected by hsa-miR-574-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-574-5p | bladder cancer | Apoptosis pathway | "Novel oncogenic function of mesoderm development c ......" | 22179486 | Luciferase; Flow cytometry |
| hsa-miR-574-5p | cervical and endocervical cancer | cell cycle pathway | "Nude mouse tumorigenicity assay was used to study ......" | 27049079 | Flow cytometry |
| hsa-miR-574-5p | colorectal cancer | cell cycle pathway | "miR 574 5p negatively regulates Qki6/7 to impact Î ......" | 22490519 | |
| hsa-miR-574-5p | thyroid cancer | cell cycle pathway; Apoptosis pathway | "Cell growth cell cycle transition and apoptosis we ......" | 23599737 | Flow cytometry; MTT assay |
Reported cancer prognosis affected by hsa-miR-574-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-574-5p | breast cancer | drug resistance | "MicroRNA 574 3p identified by microRNA library bas ......" | 25560734 | |
| hsa-miR-574-5p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
| hsa-miR-574-5p | cervical and endocervical cancer | metastasis; poor survival; cell migration | "Nude mouse tumorigenicity assay was used to study ......" | 27049079 | Flow cytometry |
| hsa-miR-574-5p | colorectal cancer | progression; differentiation | "miR 574 5p negatively regulates Qki6/7 to impact Î ......" | 22490519 | |
| hsa-miR-574-5p | colorectal cancer | metastasis | "Hsa miR 574 5p negatively regulates MACC 1 express ......" | 24936152 | Western blot; Luciferase; Colony formation |
| hsa-miR-574-5p | lung cancer | progression | "MicroRNA 574 5p was pivotal for TLR9 signaling enh ......" | 23133627 | |
| hsa-miR-574-5p | lung squamous cell cancer | poor survival; drug resistance | "miRNA microarray profiling was performed on diagno ......" | 20548249 | |
| hsa-miR-574-5p | lung squamous cell cancer | staging | "miR 1254 and miR 574 5p: serum based microRNA biom ......" | 21258252 | |
| hsa-miR-574-5p | lung squamous cell cancer | metastasis; worse prognosis | "Tumor invasion and metastasis regulated by microRN ......" | 26587830 | |
| hsa-miR-574-5p | lung squamous cell cancer | metastasis; staging | "MicroRNA 574 5p promotes metastasis of non small c ......" | 27761023 | Wound Healing Assay |
Reported gene related to hsa-miR-574-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-574-5p | cervical and endocervical cancer | QKI | "Cell wound scratch assay flow cytometry and real-t ......" | 27049079 |
| hsa-miR-574-5p | colorectal cancer | QKI | "Expression of miR-574-5p Qki5/6/7/7b splicing vari ......" | 22490519 |
| hsa-miR-574-5p | colorectal cancer | CDKN1B | "Expression of miR-574-5p Qki5/6/7/7b splicing vari ......" | 22490519 |
| hsa-miR-574-5p | lung cancer | FOXN3 | "MicroRNA 574 5p was pivotal for TLR9 signaling enh ......" | 23133627 |
| hsa-miR-574-5p | cervical and endocervical cancer | MIAT | "The results demonstrated that cervical cancer tiss ......" | 27049079 |
| hsa-miR-574-5p | thyroid cancer | PTCSC3 | "The top 20 miRNAs to have a potential interaction ......" | 23599737 |
| hsa-miR-574-5p | lung squamous cell cancer | PTPRU | "MicroRNA 574 5p promotes metastasis of non small c ......" | 27761023 |
| hsa-miR-574-5p | lung squamous cell cancer | SCLC1 | "We showed that miR-184 significantly attenuated th ......" | 26587830 |
| hsa-miR-574-5p | lung cancer | TLR9 | "MicroRNA 574 5p was pivotal for TLR9 signaling enh ......" | 23133627 |