microRNA information: hsa-miR-589-5p

SectionIDlink
Mature name: hsa-miR-589-5pmiRbase
Accession: MIMAT0004799miRbase
Precursor name: hsa-mir-589 miRbase
Precursor accession: MI0003599miRbase
Symbol: MIR589HGNC
RefSeq ID: NR_030318GenBank
Sequence: UGAGAACCACGUCUGCUCUGAG



Reported expression in cancers: hsa-miR-589-5p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-589-5p

lung squamous cell cancerdownregulation"Quantitative real-time PCR assay was employed to c ......"27073334qPCR



Reported cancer pathway affected by hsa-miR-589-5p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-589-5p

lung squamous cell cancerApoptosis pathway"Quantitative real-time PCR assay was employed to c ......"27073334Flow cytometry; Wound Healing Assay



Reported cancer prognosis affected by hsa-miR-589-5p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-589-5p

lung squamous cell cancerdrug resistance"Quantitative real-time PCR assay was employed to c ......"27073334Flow cytometry; Wound Healing Assay



Reported gene related to hsa-miR-589-5p

miRNAcancergenereportingPUBMED



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-589-5p
NPTN
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.113; TCGA ESCA -0.093; TCGA KIRC -0.142; TCGA KIRP -0.243; TCGA PRAD -0.316; TCGA SARC -0.253; TCGA THCA -0.081; TCGA STAD -0.238; TCGA UCEC -0.113
hsa-miR-589-5p
RCSD1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.253; TCGA CESC -0.219; TCGA COAD -0.31; TCGA ESCA -0.272; TCGA HNSC -0.187; TCGA LIHC -0.399; TCGA LUAD -0.149; TCGA LUSC -0.471; TCGA PRAD -0.216; TCGA STAD -0.342; TCGA UCEC -0.107
hsa-miR-589-5p
PRKAA2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.376; TCGA BRCA -0.416; TCGA COAD -1.286; TCGA ESCA -1.034; TCGA HNSC -0.773; TCGA KIRC -0.313; TCGA KIRP -0.193; TCGA PAAD -0.504; TCGA PRAD -0.132; TCGA SARC -0.981; TCGA STAD -1.575; TCGA UCEC -0.135
hsa-miR-589-5p
EYA4
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.507; TCGA BRCA -0.258; TCGA COAD -0.621; TCGA ESCA -0.862; TCGA HNSC -0.576; TCGA KIRC -1.418; TCGA KIRP -1.622; TCGA LUSC -0.564; TCGA PAAD -0.544; TCGA PRAD -0.908; TCGA THCA -0.687; TCGA STAD -0.486; TCGA UCEC -0.496
hsa-miR-589-5p
DCHS1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.439; TCGA BRCA -0.199; TCGA CESC -0.345; TCGA COAD -0.414; TCGA ESCA -0.272; TCGA HNSC -0.22; TCGA KIRC -0.18; TCGA KIRP -0.697; TCGA LIHC -0.258; TCGA LUSC -0.495; TCGA PRAD -0.477; TCGA SARC -0.312; TCGA THCA -0.36; TCGA STAD -0.487; TCGA UCEC -0.496
hsa-miR-589-5p
DPYSL2
10 cancers: BLCA; BRCA; CESC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.284; TCGA BRCA -0.178; TCGA CESC -0.162; TCGA LIHC -0.242; TCGA LUAD -0.214; TCGA LUSC -0.455; TCGA PRAD -0.311; TCGA THCA -0.172; TCGA STAD -0.138; TCGA UCEC -0.277
hsa-miR-589-5p
NBEA
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.656; TCGA BRCA -0.495; TCGA COAD -1.019; TCGA ESCA -0.697; TCGA HNSC -0.378; TCGA KIRC -0.361; TCGA KIRP -0.301; TCGA LGG -0.199; TCGA LIHC -0.341; TCGA LUSC -0.235; TCGA PRAD -0.388; TCGA SARC -0.719; TCGA STAD -1.16; TCGA UCEC -0.489
hsa-miR-589-5p
TOX
10 cancers: BLCA; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD
MirTarget
TCGA BLCA -0.195; TCGA ESCA -0.521; TCGA KIRC -0.347; TCGA KIRP -0.744; TCGA LGG -0.281; TCGA LIHC -0.661; TCGA LUAD -0.152; TCGA LUSC -0.274; TCGA PRAD -0.632; TCGA STAD -0.886
hsa-miR-589-5p
KLHL29
10 cancers: BLCA; BRCA; LUAD; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.429; TCGA BRCA -0.383; TCGA LUAD -0.205; TCGA LUSC -0.237; TCGA OV -0.183; TCGA PRAD -0.206; TCGA SARC -0.234; TCGA THCA -0.18; TCGA STAD -0.349; TCGA UCEC -0.253
hsa-miR-589-5p
HDX
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.301; TCGA BRCA -0.208; TCGA COAD -0.564; TCGA ESCA -0.419; TCGA HNSC -0.304; TCGA KIRC -0.318; TCGA KIRP -0.238; TCGA LGG -0.167; TCGA LIHC -0.234; TCGA LUSC -0.271; TCGA PAAD -0.34; TCGA PRAD -0.245; TCGA SARC -0.229; TCGA STAD -0.598; TCGA UCEC -0.395
hsa-miR-589-5p
SLC18A2
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PRAD; SARC; THCA; UCEC
MirTarget
TCGA BLCA -0.547; TCGA BRCA -0.314; TCGA CESC -0.367; TCGA ESCA -0.652; TCGA HNSC -0.392; TCGA LUSC -0.733; TCGA PRAD -0.77; TCGA SARC -0.334; TCGA THCA -0.348; TCGA UCEC -0.315
hsa-miR-589-5p
VPS13D
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; OV; PRAD; STAD
MirTarget
TCGA BLCA -0.111; TCGA BRCA -0.183; TCGA CESC -0.219; TCGA ESCA -0.254; TCGA HNSC -0.234; TCGA KIRC -0.3; TCGA KIRP -0.139; TCGA LIHC -0.076; TCGA LUSC -0.142; TCGA OV -0.115; TCGA PRAD -0.237; TCGA STAD -0.167
hsa-miR-589-5p
SESN3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; OV; PRAD; STAD
MirTarget
TCGA BLCA -0.182; TCGA BRCA -0.476; TCGA COAD -0.726; TCGA ESCA -0.505; TCGA KIRC -0.29; TCGA KIRP -0.223; TCGA LIHC -0.407; TCGA OV -0.179; TCGA PRAD -0.399; TCGA STAD -0.491
hsa-miR-589-5p
ZFHX3
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; OV; PRAD; SARC; THCA; STAD
MirTarget; miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.083; TCGA COAD -0.315; TCGA KIRC -0.261; TCGA KIRP -0.271; TCGA LIHC -0.074; TCGA OV -0.147; TCGA PRAD -0.228; TCGA SARC -0.193; TCGA THCA -0.19; TCGA STAD -0.132
hsa-miR-589-5p
BMPR1A
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.118; TCGA BRCA -0.125; TCGA COAD -0.139; TCGA ESCA -0.125; TCGA KIRC -0.245; TCGA KIRP -0.237; TCGA PAAD -0.126; TCGA PRAD -0.163; TCGA SARC -0.35; TCGA STAD -0.279; TCGA UCEC -0.123
hsa-miR-589-5p
ITGB3
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.335; TCGA BRCA -0.277; TCGA COAD -0.673; TCGA ESCA -0.272; TCGA KIRC -0.791; TCGA KIRP -1.14; TCGA LIHC -0.257; TCGA LUSC -0.494; TCGA PRAD -0.783; TCGA THCA -0.471; TCGA STAD -0.413; TCGA UCEC -0.504
hsa-miR-589-5p
PTRF
13 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.416; TCGA BRCA -0.171; TCGA COAD -0.471; TCGA ESCA -0.409; TCGA LIHC -0.176; TCGA LUAD -0.121; TCGA LUSC -0.28; TCGA PAAD -0.291; TCGA PRAD -0.462; TCGA SARC -0.092; TCGA THCA -0.431; TCGA STAD -0.719; TCGA UCEC -0.473
hsa-miR-589-5p
RBM5
9 cancers: BLCA; BRCA; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.103; TCGA BRCA -0.175; TCGA LUAD -0.08; TCGA LUSC -0.096; TCGA OV -0.112; TCGA SARC -0.2; TCGA THCA -0.14; TCGA STAD -0.085; TCGA UCEC -0.084
hsa-miR-589-5p
PCDH19
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; OV; PRAD; THCA; STAD
MirTarget
TCGA BLCA -0.303; TCGA BRCA -0.493; TCGA CESC -0.685; TCGA COAD -0.755; TCGA ESCA -0.879; TCGA HNSC -0.422; TCGA KIRC -0.555; TCGA KIRP -0.708; TCGA LGG -0.259; TCGA OV -0.271; TCGA PRAD -0.245; TCGA THCA -0.316; TCGA STAD -0.875
hsa-miR-589-5p
PRICKLE2
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.487; TCGA BRCA -0.411; TCGA COAD -0.786; TCGA ESCA -0.782; TCGA HNSC -0.312; TCGA KIRC -0.171; TCGA LIHC -0.537; TCGA LUAD -0.164; TCGA LUSC -0.481; TCGA PAAD -0.34; TCGA PRAD -0.706; TCGA SARC -0.289; TCGA STAD -0.948; TCGA UCEC -0.448
hsa-miR-589-5p
PPM1K
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; SARC; STAD; UCEC
MirTarget
TCGA BLCA -0.192; TCGA CESC -0.2; TCGA COAD -0.249; TCGA ESCA -0.251; TCGA KIRC -0.36; TCGA KIRP -0.176; TCGA LIHC -0.647; TCGA LUSC -0.213; TCGA SARC -0.293; TCGA STAD -0.429; TCGA UCEC -0.251
hsa-miR-589-5p
UNC5C
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.523; TCGA BRCA -0.515; TCGA COAD -0.524; TCGA ESCA -0.415; TCGA HNSC -0.292; TCGA KIRC -0.885; TCGA KIRP -1.559; TCGA LUSC -0.73; TCGA PRAD -0.573; TCGA SARC -0.396; TCGA THCA -0.638; TCGA STAD -0.235; TCGA UCEC -0.271
hsa-miR-589-5p
TEF
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.196; TCGA BRCA -0.227; TCGA CESC -0.379; TCGA COAD -0.161; TCGA ESCA -0.276; TCGA HNSC -0.262; TCGA KIRC -0.252; TCGA KIRP -0.156; TCGA LGG -0.129; TCGA LUAD -0.142; TCGA PAAD -0.251; TCGA PRAD -0.278; TCGA SARC -0.273; TCGA THCA -0.192; TCGA STAD -0.609; TCGA UCEC -0.268
hsa-miR-589-5p
ROR1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.534; TCGA BRCA -0.376; TCGA COAD -0.485; TCGA ESCA -0.557; TCGA HNSC -0.497; TCGA KIRP -0.316; TCGA LIHC -0.423; TCGA LUSC -0.72; TCGA OV -0.168; TCGA PRAD -0.763; TCGA SARC -0.244; TCGA THCA -0.552; TCGA STAD -0.516; TCGA UCEC -0.238
hsa-miR-589-5p
HHAT
9 cancers: BLCA; BRCA; CESC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.143; TCGA BRCA -0.244; TCGA CESC -0.298; TCGA KIRC -0.138; TCGA LUAD -0.147; TCGA PAAD -0.232; TCGA PRAD -0.472; TCGA STAD -0.252; TCGA UCEC -0.224
hsa-miR-589-5p
ST3GAL1
11 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; mirMAP
TCGA BLCA -0.205; TCGA KIRC -0.215; TCGA KIRP -0.203; TCGA LIHC -0.267; TCGA LUAD -0.239; TCGA LUSC -0.207; TCGA PAAD -0.294; TCGA PRAD -0.349; TCGA SARC -0.19; TCGA THCA -0.194; TCGA UCEC -0.151
hsa-miR-589-5p
CALCOCO1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.233; TCGA BRCA -0.314; TCGA CESC -0.294; TCGA COAD -0.261; TCGA ESCA -0.38; TCGA HNSC -0.312; TCGA KIRC -0.225; TCGA KIRP -0.1; TCGA LGG -0.058; TCGA LUAD -0.234; TCGA LUSC -0.373; TCGA OV -0.1; TCGA SARC -0.444; TCGA THCA -0.213; TCGA STAD -0.539; TCGA UCEC -0.315
hsa-miR-589-5p
ZFYVE1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PRAD; STAD; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.08; TCGA BRCA -0.132; TCGA CESC -0.142; TCGA ESCA -0.208; TCGA HNSC -0.1; TCGA KIRC -0.189; TCGA KIRP -0.145; TCGA PRAD -0.07; TCGA STAD -0.304; TCGA UCEC -0.056
hsa-miR-589-5p
ARID1B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUSC; OV; PRAD; SARC; STAD
MirTarget
TCGA BLCA -0.084; TCGA BRCA -0.154; TCGA CESC -0.145; TCGA COAD -0.091; TCGA ESCA -0.109; TCGA HNSC -0.141; TCGA KIRC -0.249; TCGA KIRP -0.266; TCGA LGG -0.058; TCGA LIHC -0.084; TCGA LUSC -0.116; TCGA OV -0.101; TCGA PRAD -0.166; TCGA SARC -0.109; TCGA STAD -0.073
hsa-miR-589-5p
MOXD1
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.39; TCGA CESC -0.578; TCGA COAD -1.141; TCGA ESCA -0.701; TCGA HNSC -0.307; TCGA KIRC -0.827; TCGA KIRP -0.766; TCGA LIHC -0.472; TCGA LUAD -0.176; TCGA LUSC -0.587; TCGA PAAD -0.582; TCGA PRAD -0.472; TCGA THCA -0.511; TCGA STAD -0.78; TCGA UCEC -0.286
hsa-miR-589-5p
FOSB
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.567; TCGA BRCA -0.61; TCGA CESC -0.379; TCGA ESCA -0.713; TCGA HNSC -0.444; TCGA KIRC -0.638; TCGA KIRP -0.701; TCGA LIHC -1.344; TCGA LUAD -0.326; TCGA LUSC -0.415; TCGA PAAD -0.565; TCGA PRAD -0.8; TCGA THCA -0.449; TCGA STAD -0.65; TCGA UCEC -0.45
hsa-miR-589-5p
GPRASP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA; UCEC
MirTarget; miRNATAP
TCGA BLCA -0.204; TCGA BRCA -0.374; TCGA CESC -0.245; TCGA COAD -0.454; TCGA ESCA -0.259; TCGA HNSC -0.164; TCGA KIRC -0.379; TCGA KIRP -0.278; TCGA LGG -0.108; TCGA LIHC -0.129; TCGA PRAD -0.191; TCGA SARC -0.414; TCGA THCA -0.086; TCGA UCEC -0.325
hsa-miR-589-5p
ATP8B2
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.338; TCGA BRCA -0.212; TCGA COAD -0.622; TCGA ESCA -0.327; TCGA KIRC -0.221; TCGA KIRP -0.128; TCGA LUSC -0.161; TCGA PRAD -0.174; TCGA SARC -0.212; TCGA THCA -0.216; TCGA STAD -0.579; TCGA UCEC -0.325
hsa-miR-589-5p
H6PD
9 cancers: BLCA; BRCA; CESC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.121; TCGA BRCA -0.204; TCGA CESC -0.148; TCGA LUSC -0.151; TCGA PAAD -0.175; TCGA PRAD -0.175; TCGA THCA -0.179; TCGA STAD -0.112; TCGA UCEC -0.191
hsa-miR-589-5p
RPS6KA2
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.334; TCGA BRCA -0.294; TCGA COAD -0.382; TCGA HNSC -0.14; TCGA KIRC -0.366; TCGA KIRP -0.228; TCGA LIHC -0.413; TCGA LUSC -0.503; TCGA PAAD -0.173; TCGA THCA -0.331; TCGA STAD -0.4; TCGA UCEC -0.371
hsa-miR-589-5p
ZNF264
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUSC; OV; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.233; TCGA ESCA -0.17; TCGA HNSC -0.144; TCGA KIRC -0.12; TCGA KIRP -0.113; TCGA LUSC -0.161; TCGA OV -0.101; TCGA PRAD -0.072; TCGA SARC -0.131; TCGA THCA -0.14; TCGA UCEC -0.21
hsa-miR-589-5p
PPP1R16B
10 cancers: BLCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.182; TCGA COAD -0.353; TCGA KIRC -0.509; TCGA KIRP -0.39; TCGA LIHC -0.353; TCGA LUAD -0.159; TCGA LUSC -0.462; TCGA PRAD -0.334; TCGA STAD -0.279; TCGA UCEC -0.324
hsa-miR-589-5p
XYLT1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.336; TCGA BRCA -0.182; TCGA CESC -0.662; TCGA COAD -0.218; TCGA ESCA -0.256; TCGA HNSC -0.286; TCGA KIRC -0.203; TCGA LGG -0.332; TCGA LIHC -0.402; TCGA LUAD -0.145; TCGA LUSC -0.598; TCGA PAAD -0.246; TCGA PRAD -0.381; TCGA THCA -0.289; TCGA STAD -0.224; TCGA UCEC -0.438
hsa-miR-589-5p
UNC5B
9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUSC; PRAD; THCA; UCEC
mirMAP
TCGA BLCA -0.154; TCGA CESC -0.42; TCGA COAD -0.329; TCGA HNSC -0.129; TCGA KIRP -0.736; TCGA LUSC -0.563; TCGA PRAD -0.579; TCGA THCA -0.492; TCGA UCEC -0.116
hsa-miR-589-5p
SH3PXD2A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.384; TCGA BRCA -0.152; TCGA CESC -0.159; TCGA COAD -0.225; TCGA ESCA -0.159; TCGA HNSC -0.097; TCGA KIRP -0.225; TCGA LUAD -0.078; TCGA LUSC -0.306; TCGA PRAD -0.44; TCGA THCA -0.259; TCGA STAD -0.275; TCGA UCEC -0.238
hsa-miR-589-5p
DPYSL3
13 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.678; TCGA COAD -1.042; TCGA ESCA -0.625; TCGA KIRP -0.7; TCGA LGG -0.105; TCGA LIHC -0.338; TCGA LUSC -0.388; TCGA PAAD -0.483; TCGA PRAD -0.452; TCGA SARC -0.324; TCGA THCA -0.849; TCGA STAD -0.859; TCGA UCEC -0.538
hsa-miR-589-5p
MEF2D
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.143; TCGA BRCA -0.144; TCGA COAD -0.178; TCGA ESCA -0.179; TCGA HNSC -0.144; TCGA KIRP -0.283; TCGA LUSC -0.165; TCGA PRAD -0.091; TCGA SARC -0.209; TCGA STAD -0.288; TCGA UCEC -0.206
hsa-miR-589-5p
C1orf21
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.239; TCGA BRCA -0.372; TCGA CESC -0.373; TCGA ESCA -0.192; TCGA HNSC -0.175; TCGA LIHC -0.335; TCGA LUAD -0.248; TCGA LUSC -0.14; TCGA SARC -0.278; TCGA STAD -0.416; TCGA UCEC -0.273
hsa-miR-589-5p
PLEKHG3
10 cancers: BLCA; BRCA; CESC; KIRC; LIHC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.2; TCGA BRCA -0.1; TCGA CESC -0.216; TCGA KIRC -0.267; TCGA LIHC -0.084; TCGA PRAD -0.283; TCGA SARC -0.536; TCGA THCA -0.133; TCGA STAD -0.182; TCGA UCEC -0.113
hsa-miR-589-5p
PHF21A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; OV; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.109; TCGA BRCA -0.087; TCGA CESC -0.167; TCGA COAD -0.18; TCGA ESCA -0.204; TCGA KIRP -0.08; TCGA LGG -0.112; TCGA LUAD -0.06; TCGA OV -0.126; TCGA PRAD -0.051; TCGA SARC -0.123; TCGA THCA -0.195; TCGA STAD -0.267; TCGA UCEC -0.121
hsa-miR-589-5p
KIAA1614
10 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.25; TCGA BRCA -0.162; TCGA COAD -0.468; TCGA ESCA -0.28; TCGA LUSC -0.302; TCGA PAAD -0.312; TCGA PRAD -0.571; TCGA SARC -0.288; TCGA STAD -0.638; TCGA UCEC -0.3
hsa-miR-589-5p
KIAA1644
13 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.934; TCGA CESC -0.308; TCGA COAD -1.028; TCGA ESCA -0.54; TCGA KIRP -0.641; TCGA LGG -0.604; TCGA LIHC -0.849; TCGA LUAD -0.285; TCGA LUSC -0.511; TCGA PRAD -0.893; TCGA THCA -0.395; TCGA STAD -1.218; TCGA UCEC -0.975
hsa-miR-589-5p
WTIP
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.101; TCGA COAD -0.601; TCGA ESCA -0.358; TCGA KIRC -0.582; TCGA KIRP -0.43; TCGA LIHC -0.262; TCGA LUSC -0.285; TCGA PAAD -0.455; TCGA THCA -0.441; TCGA STAD -0.531; TCGA UCEC -0.23
hsa-miR-589-5p
SHROOM4
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.243; TCGA BRCA -0.302; TCGA CESC -0.471; TCGA COAD -0.45; TCGA ESCA -0.257; TCGA HNSC -0.347; TCGA KIRC -0.384; TCGA KIRP -0.394; TCGA LIHC -0.261; TCGA LUAD -0.202; TCGA LUSC -0.558; TCGA PAAD -0.227; TCGA PRAD -0.42; TCGA THCA -0.874; TCGA STAD -0.148; TCGA UCEC -0.34
hsa-miR-589-5p
PRKCB
9 cancers: BLCA; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.544; TCGA COAD -0.566; TCGA ESCA -0.37; TCGA LIHC -0.553; TCGA LUAD -0.192; TCGA LUSC -0.405; TCGA PRAD -0.746; TCGA STAD -0.707; TCGA UCEC -0.203
hsa-miR-589-5p
MECP2
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.103; TCGA BRCA -0.125; TCGA CESC -0.114; TCGA ESCA -0.153; TCGA KIRC -0.154; TCGA KIRP -0.251; TCGA PRAD -0.148; TCGA SARC -0.096; TCGA THCA -0.082; TCGA STAD -0.226; TCGA UCEC -0.128
hsa-miR-589-5p
MN1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.427; TCGA BRCA -0.178; TCGA COAD -0.94; TCGA ESCA -0.608; TCGA HNSC -0.198; TCGA KIRP -0.616; TCGA LGG -0.273; TCGA LIHC -0.355; TCGA PAAD -0.297; TCGA PRAD -0.485; TCGA THCA -0.532; TCGA STAD -0.807; TCGA UCEC -0.338
hsa-miR-589-5p
KLF13
10 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; LUSC; OV; PAAD; PRAD; UCEC
mirMAP
TCGA BLCA -0.16; TCGA BRCA -0.119; TCGA KIRC -0.19; TCGA KIRP -0.131; TCGA LUAD -0.133; TCGA LUSC -0.407; TCGA OV -0.095; TCGA PAAD -0.202; TCGA PRAD -0.344; TCGA UCEC -0.126
hsa-miR-589-5p
CTDSP2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; OV; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.207; TCGA CESC -0.158; TCGA COAD -0.12; TCGA HNSC -0.102; TCGA KIRC -0.257; TCGA KIRP -0.282; TCGA LUSC -0.171; TCGA OV -0.132; TCGA PRAD -0.179; TCGA STAD -0.168; TCGA UCEC -0.206
hsa-miR-589-5p
SORCS2
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.577; TCGA BRCA -0.385; TCGA COAD -0.709; TCGA ESCA -0.813; TCGA HNSC -0.239; TCGA KIRC -0.951; TCGA KIRP -1.9; TCGA LIHC -0.527; TCGA LUAD -0.467; TCGA LUSC -0.913; TCGA PAAD -0.714; TCGA PRAD -0.536; TCGA THCA -0.755; TCGA STAD -0.662; TCGA UCEC -0.726
hsa-miR-589-5p
C3orf70
12 cancers: BLCA; CESC; COAD; KIRP; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.312; TCGA CESC -0.651; TCGA COAD -0.419; TCGA KIRP -0.783; TCGA LGG -0.157; TCGA LIHC -0.117; TCGA LUSC -0.462; TCGA PRAD -0.64; TCGA SARC -0.897; TCGA THCA -0.23; TCGA STAD -0.876; TCGA UCEC -0.746
hsa-miR-589-5p
SFMBT2
10 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LIHC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.296; TCGA BRCA -0.206; TCGA COAD -0.399; TCGA ESCA -0.472; TCGA KIRP -0.381; TCGA LIHC -0.523; TCGA LUSC -0.381; TCGA PRAD -0.422; TCGA STAD -0.175; TCGA UCEC -0.36
hsa-miR-589-5p
NEURL1B
11 cancers: BLCA; CESC; COAD; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.126; TCGA CESC -0.49; TCGA COAD -0.179; TCGA KIRP -0.47; TCGA LGG -0.113; TCGA LUSC -0.437; TCGA PRAD -0.332; TCGA SARC -0.518; TCGA THCA -0.316; TCGA STAD -0.419; TCGA UCEC -0.284
hsa-miR-589-5p
NPR3
9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; STAD; UCEC
miRNATAP
TCGA BLCA -0.476; TCGA COAD -1.457; TCGA ESCA -0.577; TCGA HNSC -0.407; TCGA KIRC -0.839; TCGA LIHC -0.752; TCGA LUSC -0.422; TCGA STAD -1.083; TCGA UCEC -0.493
hsa-miR-589-5p
ROBO1
9 cancers: BLCA; COAD; KIRC; KIRP; LGG; PAAD; PRAD; THCA; STAD
miRNATAP
TCGA BLCA -0.199; TCGA COAD -0.435; TCGA KIRC -0.367; TCGA KIRP -0.59; TCGA LGG -0.273; TCGA PAAD -0.343; TCGA PRAD -0.539; TCGA THCA -0.34; TCGA STAD -0.323
hsa-miR-589-5p
ADAMTS18
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUSC; SARC; THCA; UCEC
miRNATAP
TCGA BLCA -0.388; TCGA BRCA -0.571; TCGA COAD -1.124; TCGA HNSC -0.284; TCGA KIRP -0.793; TCGA LUSC -0.551; TCGA SARC -0.544; TCGA THCA -0.639; TCGA UCEC -0.275
hsa-miR-589-5p
DLL1
10 cancers: BLCA; BRCA; KIRP; LGG; LIHC; LUAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.203; TCGA KIRP -1.082; TCGA LGG -0.483; TCGA LIHC -0.633; TCGA LUAD -0.189; TCGA PRAD -0.161; TCGA THCA -0.423; TCGA STAD -0.165; TCGA UCEC -0.409
hsa-miR-589-5p
GRIA3
11 cancers: BLCA; BRCA; ESCA; LGG; LIHC; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.435; TCGA BRCA -0.214; TCGA ESCA -0.461; TCGA LGG -0.297; TCGA LIHC -0.814; TCGA LUSC -0.512; TCGA PRAD -0.62; TCGA SARC -0.602; TCGA THCA -0.748; TCGA STAD -0.778; TCGA UCEC -0.721
hsa-miR-589-5p
RARB
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.606; TCGA BRCA -0.219; TCGA CESC -0.755; TCGA COAD -0.58; TCGA ESCA -0.608; TCGA HNSC -0.294; TCGA KIRC -0.394; TCGA KIRP -0.166; TCGA LIHC -0.511; TCGA LUAD -0.11; TCGA LUSC -0.367; TCGA PRAD -0.316; TCGA SARC -0.267; TCGA STAD -0.425; TCGA UCEC -0.194
hsa-miR-589-5p
NEFM
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.35; TCGA BRCA -0.474; TCGA CESC -0.664; TCGA COAD -0.986; TCGA HNSC -0.556; TCGA PRAD -0.818; TCGA SARC -0.57; TCGA STAD -1.316; TCGA UCEC -0.888
hsa-miR-589-5p
VASN
9 cancers: BLCA; COAD; HNSC; KIRP; LUSC; OV; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.189; TCGA COAD -0.371; TCGA HNSC -0.31; TCGA KIRP -0.226; TCGA LUSC -0.343; TCGA OV -0.154; TCGA THCA -0.554; TCGA STAD -0.228; TCGA UCEC -0.245
hsa-miR-589-5p
ADARB1
12 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; OV; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.318; TCGA COAD -0.18; TCGA ESCA -0.317; TCGA KIRC -0.157; TCGA KIRP -0.376; TCGA LIHC -0.279; TCGA LUAD -0.12; TCGA LUSC -0.446; TCGA OV -0.122; TCGA THCA -0.328; TCGA STAD -0.43; TCGA UCEC -0.284
hsa-miR-589-5p
SEMA3G
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.324; TCGA BRCA -0.448; TCGA CESC -0.369; TCGA COAD -0.665; TCGA HNSC -0.505; TCGA KIRC -0.871; TCGA KIRP -0.808; TCGA LUSC -0.351; TCGA SARC -0.36; TCGA THCA -0.204; TCGA STAD -0.432; TCGA UCEC -0.221
hsa-miR-589-5p
SOX5
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LIHC; LUAD; OV; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.437; TCGA BRCA -0.25; TCGA COAD -0.84; TCGA KIRC -0.594; TCGA KIRP -1.227; TCGA LIHC -0.218; TCGA LUAD -0.166; TCGA OV -0.233; TCGA PRAD -0.635; TCGA SARC -0.544; TCGA STAD -0.663; TCGA UCEC -0.265
hsa-miR-589-5p
SLITRK4
10 cancers: BLCA; CESC; ESCA; HNSC; LGG; PAAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.526; TCGA CESC -0.429; TCGA ESCA -0.558; TCGA HNSC -0.875; TCGA LGG -0.293; TCGA PAAD -0.485; TCGA PRAD -0.646; TCGA THCA -0.327; TCGA STAD -0.773; TCGA UCEC -0.407
hsa-miR-589-5p
SMAD4
12 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.088; TCGA BRCA -0.184; TCGA HNSC -0.089; TCGA KIRC -0.193; TCGA KIRP -0.147; TCGA LGG -0.113; TCGA LUAD -0.08; TCGA LUSC -0.083; TCGA PRAD -0.098; TCGA SARC -0.189; TCGA STAD -0.174; TCGA UCEC -0.136
hsa-miR-589-5p
CELF2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.66; TCGA CESC -0.227; TCGA COAD -0.295; TCGA ESCA -0.705; TCGA HNSC -0.294; TCGA LIHC -0.407; TCGA LUAD -0.234; TCGA LUSC -0.515; TCGA PRAD -0.457; TCGA STAD -0.728; TCGA UCEC -0.245
hsa-miR-589-5p
SLITRK3
9 cancers: BLCA; COAD; ESCA; LIHC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.754; TCGA COAD -1.665; TCGA ESCA -2.055; TCGA LIHC -1.023; TCGA PAAD -0.942; TCGA PRAD -1.119; TCGA SARC -0.789; TCGA STAD -1.909; TCGA UCEC -1.06
hsa-miR-589-5p
SCN3B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; OV; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.438; TCGA BRCA -0.736; TCGA CESC -0.687; TCGA COAD -0.814; TCGA ESCA -0.753; TCGA HNSC -0.505; TCGA LGG -0.481; TCGA LUAD -0.179; TCGA LUSC -0.61; TCGA OV -0.348; TCGA PRAD -0.604; TCGA THCA -0.259; TCGA STAD -0.915; TCGA UCEC -0.8
hsa-miR-589-5p
FBXL5
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD
miRNATAP
TCGA BLCA -0.134; TCGA BRCA -0.198; TCGA COAD -0.193; TCGA ESCA -0.19; TCGA HNSC -0.189; TCGA LIHC -0.167; TCGA LUAD -0.095; TCGA LUSC -0.109; TCGA PRAD -0.138; TCGA SARC -0.134; TCGA STAD -0.282
hsa-miR-589-5p
NOVA1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.832; TCGA BRCA -0.741; TCGA CESC -0.666; TCGA COAD -1.038; TCGA ESCA -0.783; TCGA HNSC -0.442; TCGA LGG -0.255; TCGA PRAD -0.552; TCGA THCA -0.816; TCGA STAD -1.354; TCGA UCEC -0.755
hsa-miR-589-5p
PLP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.878; TCGA BRCA -0.804; TCGA CESC -0.688; TCGA COAD -1.765; TCGA ESCA -1.814; TCGA HNSC -0.899; TCGA KIRC -1.146; TCGA KIRP -0.666; TCGA LUSC -0.518; TCGA PRAD -0.87; TCGA THCA -0.996; TCGA STAD -2.218; TCGA UCEC -0.901
hsa-miR-589-5p
PIP5K1B
9 cancers: BLCA; BRCA; HNSC; KIRC; LIHC; LUAD; PRAD; SARC; UCEC
miRNATAP
TCGA BLCA -0.22; TCGA BRCA -0.192; TCGA HNSC -0.307; TCGA KIRC -0.817; TCGA LIHC -0.371; TCGA LUAD -0.35; TCGA PRAD -0.557; TCGA SARC -0.329; TCGA UCEC -0.323
hsa-miR-589-5p
MXD4
11 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; OV; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.205; TCGA BRCA -0.171; TCGA ESCA -0.172; TCGA HNSC -0.201; TCGA LGG -0.117; TCGA LUAD -0.129; TCGA LUSC -0.237; TCGA OV -0.157; TCGA THCA -0.168; TCGA STAD -0.25; TCGA UCEC -0.097
hsa-miR-589-5p
FAM65B
10 cancers: BLCA; CESC; COAD; ESCA; LIHC; LUAD; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.334; TCGA CESC -0.291; TCGA COAD -0.505; TCGA ESCA -0.323; TCGA LIHC -0.46; TCGA LUAD -0.19; TCGA PRAD -0.489; TCGA THCA -0.399; TCGA STAD -0.294; TCGA UCEC -0.58
hsa-miR-589-5p
ZDHHC17
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; OV; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.074; TCGA BRCA -0.185; TCGA CESC -0.111; TCGA ESCA -0.143; TCGA KIRP -0.087; TCGA OV -0.138; TCGA SARC -0.217; TCGA STAD -0.086; TCGA UCEC -0.124
hsa-miR-589-5p
C16orf52
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; OV; PAAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.058; TCGA BRCA -0.165; TCGA CESC -0.083; TCGA COAD -0.13; TCGA ESCA -0.116; TCGA KIRC -0.113; TCGA KIRP -0.088; TCGA LIHC -0.103; TCGA LUAD -0.067; TCGA OV -0.08; TCGA PAAD -0.178; TCGA STAD -0.089; TCGA UCEC -0.18
hsa-miR-589-5p
TCF4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.308; TCGA BRCA -0.205; TCGA CESC -0.257; TCGA COAD -0.662; TCGA ESCA -0.24; TCGA HNSC -0.228; TCGA KIRP -0.416; TCGA LGG -0.227; TCGA LIHC -0.293; TCGA LUAD -0.176; TCGA LUSC -0.233; TCGA PRAD -0.34; TCGA STAD -0.268; TCGA UCEC -0.367
hsa-miR-589-5p
SYNPO
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.353; TCGA BRCA -0.189; TCGA CESC -0.261; TCGA COAD -0.406; TCGA ESCA -0.405; TCGA HNSC -0.212; TCGA KIRP -0.661; TCGA LIHC -0.227; TCGA LUAD -0.198; TCGA LUSC -0.677; TCGA PAAD -0.314; TCGA PRAD -0.364; TCGA SARC -0.309; TCGA THCA -0.504; TCGA STAD -0.515; TCGA UCEC -0.409
hsa-miR-589-5p
ZNF365
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.256; TCGA BRCA -0.135; TCGA COAD -0.654; TCGA ESCA -0.672; TCGA HNSC -0.238; TCGA LUSC -0.546; TCGA PRAD -0.463; TCGA THCA -0.788; TCGA STAD -0.425; TCGA UCEC -0.237
hsa-miR-589-5p
CREBL2
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.178; TCGA CESC -0.116; TCGA ESCA -0.171; TCGA KIRC -0.077; TCGA LIHC -0.264; TCGA LUAD -0.154; TCGA LUSC -0.134; TCGA PRAD -0.109; TCGA STAD -0.178; TCGA UCEC -0.064
hsa-miR-589-5p
KIAA0141
10 cancers: BLCA; BRCA; CESC; HNSC; LIHC; LUAD; LUSC; OV; SARC; STAD
miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.157; TCGA CESC -0.093; TCGA HNSC -0.063; TCGA LIHC -0.061; TCGA LUAD -0.144; TCGA LUSC -0.173; TCGA OV -0.077; TCGA SARC -0.108; TCGA STAD -0.099
hsa-miR-589-5p
ST5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; OV; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.328; TCGA BRCA -0.154; TCGA CESC -0.224; TCGA COAD -0.206; TCGA ESCA -0.205; TCGA LUAD -0.129; TCGA LUSC -0.24; TCGA OV -0.084; TCGA PAAD -0.18; TCGA PRAD -0.447; TCGA SARC -0.379; TCGA THCA -0.151; TCGA STAD -0.414; TCGA UCEC -0.36
hsa-miR-589-5p
TET2
11 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; PRAD; SARC; THCA
MirTarget
TCGA BRCA -0.147; TCGA CESC -0.202; TCGA ESCA -0.138; TCGA HNSC -0.139; TCGA KIRC -0.189; TCGA KIRP -0.166; TCGA LGG -0.118; TCGA LIHC -0.223; TCGA PRAD -0.142; TCGA SARC -0.129; TCGA THCA -0.094
hsa-miR-589-5p
ARHGAP29
12 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUSC; OV; PRAD; SARC; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.215; TCGA COAD -0.262; TCGA KIRC -0.327; TCGA KIRP -0.312; TCGA LIHC -0.249; TCGA LUSC -0.243; TCGA OV -0.129; TCGA PRAD -0.174; TCGA SARC -0.178; TCGA THCA -0.295; TCGA STAD -0.129; TCGA UCEC -0.172
hsa-miR-589-5p
MOCS1
12 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget
TCGA BRCA -0.252; TCGA COAD -0.382; TCGA ESCA -0.219; TCGA HNSC -0.251; TCGA KIRC -0.376; TCGA KIRP -0.254; TCGA LUAD -0.284; TCGA LUSC -0.554; TCGA PRAD -0.282; TCGA SARC -0.174; TCGA STAD -0.71; TCGA UCEC -0.098
hsa-miR-589-5p
ERRFI1
9 cancers: BRCA; KIRC; KIRP; LIHC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA BRCA -0.152; TCGA KIRC -0.271; TCGA KIRP -0.957; TCGA LIHC -0.371; TCGA PAAD -0.276; TCGA PRAD -0.158; TCGA THCA -0.328; TCGA STAD -0.317; TCGA UCEC -0.138
hsa-miR-589-5p
AK5
9 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; STAD; UCEC
MirTarget
TCGA BRCA -1.018; TCGA COAD -0.774; TCGA ESCA -0.573; TCGA HNSC -0.35; TCGA KIRC -0.788; TCGA KIRP -1.078; TCGA LUSC -0.416; TCGA STAD -0.616; TCGA UCEC -0.162
hsa-miR-589-5p
FAM110C
10 cancers: BRCA; CESC; HNSC; KIRP; LIHC; LUAD; OV; PAAD; PRAD; THCA
MirTarget
TCGA BRCA -0.228; TCGA CESC -0.258; TCGA HNSC -0.345; TCGA KIRP -0.333; TCGA LIHC -0.543; TCGA LUAD -0.255; TCGA OV -0.233; TCGA PAAD -0.36; TCGA PRAD -0.625; TCGA THCA -0.254
hsa-miR-589-5p
ENDOD1
10 cancers: BRCA; CESC; ESCA; HNSC; KIRP; LIHC; PAAD; SARC; THCA; STAD
MirTarget
TCGA BRCA -0.177; TCGA CESC -0.178; TCGA ESCA -0.317; TCGA HNSC -0.305; TCGA KIRP -0.171; TCGA LIHC -0.564; TCGA PAAD -0.231; TCGA SARC -0.356; TCGA THCA -0.452; TCGA STAD -0.192
hsa-miR-589-5p
SUFU
10 cancers: BRCA; CESC; COAD; HNSC; LGG; LIHC; LUSC; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.068; TCGA CESC -0.099; TCGA COAD -0.1; TCGA HNSC -0.1; TCGA LGG -0.103; TCGA LIHC -0.089; TCGA LUSC -0.088; TCGA THCA -0.167; TCGA STAD -0.169; TCGA UCEC -0.095
hsa-miR-589-5p
SEMA5A
12 cancers: BRCA; CESC; COAD; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BRCA -0.412; TCGA CESC -0.529; TCGA COAD -0.283; TCGA KIRC -0.597; TCGA LGG -0.297; TCGA LIHC -0.246; TCGA LUAD -0.19; TCGA LUSC -0.847; TCGA PRAD -0.704; TCGA SARC -0.264; TCGA THCA -0.388; TCGA UCEC -0.357
hsa-miR-589-5p
RNF165
9 cancers: BRCA; KIRP; LGG; LIHC; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.346; TCGA KIRP -0.771; TCGA LGG -0.418; TCGA LIHC -0.703; TCGA LUSC -0.407; TCGA PRAD -0.783; TCGA SARC -0.995; TCGA STAD -0.955; TCGA UCEC -0.325
hsa-miR-589-5p
VANGL2
11 cancers: BRCA; CESC; COAD; KIRC; LGG; LIHC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BRCA -0.202; TCGA CESC -0.326; TCGA COAD -1.034; TCGA KIRC -0.634; TCGA LGG -0.129; TCGA LIHC -0.402; TCGA PAAD -0.333; TCGA PRAD -0.548; TCGA SARC -0.377; TCGA THCA -0.207; TCGA STAD -0.525
hsa-miR-589-5p
KIRREL
9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BRCA -0.436; TCGA COAD -0.579; TCGA KIRC -0.623; TCGA KIRP -0.811; TCGA LIHC -0.511; TCGA LUSC -0.311; TCGA PRAD -0.76; TCGA STAD -0.307; TCGA UCEC -0.456
hsa-miR-589-5p
MAPT
9 cancers: BRCA; COAD; ESCA; HNSC; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BRCA -0.829; TCGA COAD -0.809; TCGA ESCA -0.586; TCGA HNSC -0.732; TCGA LGG -0.188; TCGA PRAD -0.161; TCGA SARC -0.566; TCGA STAD -1.205; TCGA UCEC -0.3
hsa-miR-589-5p
SHISA6
11 cancers: BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BRCA -0.385; TCGA COAD -0.578; TCGA ESCA -0.841; TCGA HNSC -0.724; TCGA KIRC -0.652; TCGA KIRP -0.739; TCGA PAAD -0.527; TCGA PRAD -0.187; TCGA THCA -1.219; TCGA STAD -0.704; TCGA UCEC -0.489
hsa-miR-589-5p
SRGAP3
10 cancers: BRCA; ESCA; KIRC; KIRP; LGG; LIHC; OV; PRAD; THCA; UCEC
mirMAP; miRNATAP
TCGA BRCA -0.161; TCGA ESCA -0.39; TCGA KIRC -0.58; TCGA KIRP -0.243; TCGA LGG -0.199; TCGA LIHC -0.223; TCGA OV -0.225; TCGA PRAD -0.323; TCGA THCA -0.367; TCGA UCEC -0.11
hsa-miR-589-5p
EFNB2
9 cancers: BRCA; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; THCA; UCEC
miRNATAP
TCGA BRCA -0.163; TCGA COAD -0.186; TCGA KIRC -0.265; TCGA KIRP -0.35; TCGA LIHC -0.252; TCGA LUAD -0.171; TCGA LUSC -0.28; TCGA THCA -0.261; TCGA UCEC -0.32
hsa-miR-589-5p
PAPPA
11 cancers: BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRNATAP
TCGA BRCA -0.268; TCGA COAD -0.402; TCGA ESCA -0.311; TCGA KIRC -1.073; TCGA LIHC -0.61; TCGA LUAD -0.489; TCGA LUSC -0.651; TCGA PRAD -0.67; TCGA THCA -0.517; TCGA STAD -0.18; TCGA UCEC -0.827
hsa-miR-589-5p
ERBB4
10 cancers: BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
miRNATAP
TCGA BRCA -1.176; TCGA ESCA -0.613; TCGA HNSC -0.993; TCGA KIRC -2.536; TCGA KIRP -2.629; TCGA LUAD -0.371; TCGA LUSC -0.719; TCGA PRAD -0.247; TCGA THCA -0.38; TCGA STAD -0.686
hsa-miR-589-5p
TAF9B
9 cancers: BRCA; CESC; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BRCA -0.123; TCGA CESC -0.121; TCGA KIRC -0.198; TCGA KIRP -0.308; TCGA LGG -0.096; TCGA PRAD -0.137; TCGA SARC -0.168; TCGA STAD -0.246; TCGA UCEC -0.09
hsa-miR-589-5p
PPP2R3A
10 cancers: CESC; COAD; ESCA; HNSC; KIRC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget
TCGA CESC -0.357; TCGA COAD -0.323; TCGA ESCA -0.578; TCGA HNSC -0.269; TCGA KIRC -0.23; TCGA PAAD -0.293; TCGA PRAD -0.195; TCGA THCA -0.119; TCGA STAD -0.724; TCGA UCEC -0.19
hsa-miR-589-5p
CNTFR
12 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA CESC -0.626; TCGA ESCA -0.583; TCGA HNSC -0.586; TCGA KIRC -0.714; TCGA KIRP -0.604; TCGA LGG -0.343; TCGA LIHC -0.731; TCGA LUAD -0.435; TCGA PRAD -0.559; TCGA SARC -0.964; TCGA STAD -1.34; TCGA UCEC -0.783





Enriched cancer pathways of putative targets