microRNA information: hsa-miR-592
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-592 | miRbase |
Accession: | MIMAT0003260 | miRbase |
Precursor name: | hsa-mir-592 | miRbase |
Precursor accession: | MI0003604 | miRbase |
Symbol: | MIR592 | HGNC |
RefSeq ID: | NR_030323 | GenBank |
Sequence: | UUGUGUCAAUAUGCGAUGAUGU |
Reported expression in cancers: hsa-miR-592
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-592 | colorectal cancer | deregulation | "Of the 99 mCRC patients we studied differential mi ......" | 23098991 | Microarray |
hsa-miR-592 | colorectal cancer | deregulation | "Deep Sequencing the MicroRNA Transcriptome in Colo ......" | 23824282 | RNA-Seq |
hsa-miR-592 | colorectal cancer | deregulation | "Up regulation of miR 592 correlates with tumor pro ......" | 25661360 | |
hsa-miR-592 | colorectal cancer | downregulation | "Previous studies have shown that miR-592 play crit ......" | 26064240 | |
hsa-miR-592 | colorectal cancer | upregulation | "Here we interrogate the biological significance of ......" | 27167185 | qPCR |
hsa-miR-592 | liver cancer | deregulation | "In this study we identified 10 upregulated miRNAs ......" | 22362728 | qPCR |
hsa-miR-592 | liver cancer | deregulation | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Microarray; Reverse transcription PCR |
hsa-miR-592 | lung cancer | deregulation | "Therefore we conduct to systematically identify mi ......" | 26870998 | Microarray |
hsa-miR-592 | prostate cancer | upregulation | "In the present study the effect of miR-592 on the ......" | 26629010 |
Reported cancer pathway affected by hsa-miR-592
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-592 | colorectal cancer | Apoptosis pathway | "Up regulation of miR 592 correlates with tumor pro ......" | 25661360 |
Reported cancer prognosis affected by hsa-miR-592
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-592 | colon cancer | staging | "We assessed by qRT-PCR expression of 754 microRNAs ......" | 27485175 | |
hsa-miR-592 | colorectal cancer | progression | "Of the 99 mCRC patients we studied differential mi ......" | 23098991 | |
hsa-miR-592 | colorectal cancer | progression; worse prognosis; staging; metastasis; poor survival; tumor size | "Up regulation of miR 592 correlates with tumor pro ......" | 25661360 | |
hsa-miR-592 | colorectal cancer | tumorigenesis; metastasis; progression | "An oncogenic role of miR 592 in tumorigenesis of h ......" | 27167185 | |
hsa-miR-592 | lung cancer | metastasis | "miR 592 and miR 552 can distinguish between primar ......" | 24778034 |
Reported gene related to hsa-miR-592
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-592 | colorectal cancer | FOXO3 | "An oncogenic role of miR 592 in tumorigenesis of h ......" | 27167185 |
hsa-miR-592 | prostate cancer | FOXO3 | "MiR 592 represses FOXO3 expression and promotes th ......" | 26629010 |
hsa-miR-592 | colorectal cancer | CCND3 | "MiR 592 inhibited cell proliferation of human colo ......" | 26064240 |
hsa-miR-592 | liver cancer | DEK | "MicroRNA 592 targets DEK oncogene and suppresses c ......" | 26722432 |
hsa-miR-592 | colon cancer | MRC1 | "The expression of miR-592 was significantly associ ......" | 27485175 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-592 | HIPK3 | 9 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; PAAD; THCA; UCEC | MirTarget | TCGA BLCA -0.097; TCGA CESC -0.12; TCGA COAD -0.056; TCGA ESCA -0.088; TCGA KIRC -0.11; TCGA KIRP -0.205; TCGA PAAD -0.18; TCGA THCA -0.12; TCGA UCEC -0.139 |
hsa-miR-592 | LEPROT | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; PAAD; THCA; UCEC | miRNATAP | TCGA BLCA -0.095; TCGA CESC -0.152; TCGA COAD -0.05; TCGA ESCA -0.08; TCGA KIRC -0.076; TCGA KIRP -0.145; TCGA LGG -0.143; TCGA PAAD -0.19; TCGA THCA -0.117; TCGA UCEC -0.163 |
Enriched cancer pathways of putative targets