microRNA information: hsa-miR-595
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-595 | miRbase |
| Accession: | MIMAT0003263 | miRbase |
| Precursor name: | hsa-mir-595 | miRbase |
| Precursor accession: | MI0003607 | miRbase |
| Symbol: | MIR595 | HGNC |
| RefSeq ID: | NR_030325 | GenBank |
| Sequence: | GAAGUGUGCCGUGGUGUGUCU |
Reported expression in cancers: hsa-miR-595
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-595 | glioblastoma | upregulation | "Recently miR-595 was reported as a tumor promoter ......" | 27133048 |
Reported cancer pathway affected by hsa-miR-595
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-595
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-595 | glioblastoma | malignant trasformation; tumorigenesis | "MiR 595 targeting regulation of SOX7 expression pr ......" | 27133048 | Colony formation; Luciferase |
Reported gene related to hsa-miR-595
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-595 | thyroid cancer | IL22 | "Interestingly in PTC cell lines and PTC tissues ex ......" | 27022736 |
| hsa-miR-595 | thyroid cancer | SOX17 | "Further mechanistic studies revealed that sex-dete ......" | 27022736 |
| hsa-miR-595 | glioblastoma | SOX7 | "MiR 595 targeting regulation of SOX7 expression pr ......" | 27133048 |