microRNA information: hsa-miR-596
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-596 | miRbase |
| Accession: | MIMAT0003264 | miRbase |
| Precursor name: | hsa-mir-596 | miRbase |
| Precursor accession: | MI0003608 | miRbase |
| Symbol: | MIR596 | HGNC |
| RefSeq ID: | NR_030326 | GenBank |
| Sequence: | AAGCCUGCCCGGCUCCUCGGG |
Reported expression in cancers: hsa-miR-596
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-596
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-596
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-596 | colon cancer | recurrence | "Groups of five patients with and without disease r ......" | 24400111 |
Reported gene related to hsa-miR-596
| miRNA | cancer | gene | reporting | PUBMED |
|---|