microRNA information: hsa-miR-602
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-602 | miRbase |
| Accession: | MIMAT0003270 | miRbase |
| Precursor name: | hsa-mir-602 | miRbase |
| Precursor accession: | MI0003615 | miRbase |
| Symbol: | MIR602 | HGNC |
| RefSeq ID: | NR_030333 | GenBank |
| Sequence: | GACACGGGCGACAGCUGCGGCCC |
Reported expression in cancers: hsa-miR-602
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-602
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-602 | liver cancer | Apoptosis pathway | "MicroRNA 602 regulating tumor suppressive gene RAS ......" | 20364114 | Western blot |
Reported cancer prognosis affected by hsa-miR-602
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-602 | liver cancer | tumorigenesis | "MicroRNA 602 regulating tumor suppressive gene RAS ......" | 20364114 | Western blot |
Reported gene related to hsa-miR-602
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-602 | liver cancer | RASSF1 | "MicroRNA 602 regulating tumor suppressive gene RAS ......" | 20364114 |
| hsa-miR-602 | liver cancer | TP73 | "2 MicroRNA-602 expression in HepG2 and HepG2-HBX w ......" | 20364114 |