microRNA information: hsa-miR-608
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-608 | miRbase |
| Accession: | MIMAT0003276 | miRbase |
| Precursor name: | hsa-mir-608 | miRbase |
| Precursor accession: | MI0003621 | miRbase |
| Symbol: | MIR608 | HGNC |
| RefSeq ID: | NR_030339 | GenBank |
| Sequence: | AGGGGUGGUGUUGGGACAGCUCCGU |
Reported expression in cancers: hsa-miR-608
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-608
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-608 | chordoma | Apoptosis pathway | "MicroRNA 608 and microRNA 34a regulate chordoma ma ......" | 24621885 | |
| hsa-miR-608 | colon cancer | cell cycle pathway; Apoptosis pathway | "microRNA 342 5p and miR 608 inhibit colon cancer t ......" | 26646451 |
Reported cancer prognosis affected by hsa-miR-608
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-608 | breast cancer | tumorigenesis | "Polymorphism rs4919510:C>G in mature sequence of h ......" | 22586447 | |
| hsa-miR-608 | colon cancer | tumorigenesis; progression | "microRNA 342 5p and miR 608 inhibit colon cancer t ......" | 26646451 | |
| hsa-miR-608 | colorectal cancer | metastasis; recurrence | "Also single nucleotide polymorphisms of genes enco ......" | 23173124 | |
| hsa-miR-608 | esophageal cancer | recurrence | "In the training group only the rs4919510 SNP of th ......" | 24770678 | |
| hsa-miR-608 | liver cancer | metastasis; staging; poor survival; differentiation; tumor size | "MicroRNA 608 acts as a prognostic marker and inhib ......" | 26474589 | |
| hsa-miR-608 | liver cancer | worse prognosis | "MiR 608 rs4919510 is associated with prognosis of ......" | 26815502 | |
| hsa-miR-608 | lung cancer | worse prognosis | "This study was implemented to investigate the asso ......" | 25614447 |
Reported gene related to hsa-miR-608
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-608 | esophageal cancer | CTSG | "In the training group only the rs4919510 SNP of th ......" | 24770678 |
| hsa-miR-608 | gastric cancer | CTSG | "A similar tendency was observed in a recessive mod ......" | 24475294 |
| hsa-miR-608 | lung cancer | BCL2L1 | "Combination of siRNA based silencing of bcl-xL siB ......" | 24339958 |
| hsa-miR-608 | chordoma | CHDM | "We find that miR-608 and miR-34a expressions are d ......" | 24621885 |
| hsa-miR-608 | chordoma | EGFR | "We find that miR-34a inversely correlates with MET ......" | 24621885 |
| hsa-miR-608 | breast cancer | ERBB2 | "Polymorphism rs4919510:C>G in mature sequence of h ......" | 22586447 |
| hsa-miR-608 | esophageal cancer | GEMIN4 | "In a combined analysis we demonstrated the cumulat ......" | 24770678 |
| hsa-miR-608 | breast cancer | HSF1 | "Bioinformatic analysis indicated that HSF1 which i ......" | 22586447 |
| hsa-miR-608 | liver cancer | MIF | "Macrophage migration inhibitory factor MIF a poten ......" | 26474589 |
| hsa-miR-608 | colon cancer | NAA10 | "microRNA 342 5p and miR 608 inhibit colon cancer t ......" | 26646451 |
| hsa-miR-608 | esophageal cancer | RAN | "In a combined analysis we demonstrated the cumulat ......" | 24770678 |