microRNA information: hsa-miR-612
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-612 | miRbase |
| Accession: | MIMAT0003280 | miRbase |
| Precursor name: | hsa-mir-612 | miRbase |
| Precursor accession: | MI0003625 | miRbase |
| Symbol: | MIR612 | HGNC |
| RefSeq ID: | NR_030343 | GenBank |
| Sequence: | GCUGGGCAGGGCUUCUGAGCUCCUU |
Reported expression in cancers: hsa-miR-612
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-612 | NA | NA | "NA ......" | NA | NA |
| hsa-miR-612 | " ......" |
Reported cancer pathway affected by hsa-miR-612
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-612 | colorectal cancer | Epithelial mesenchymal transition pathway | "miR 612 negatively regulates colorectal cancer gro ......" | 26158514 | Transwell assay |
| hsa-miR-612 | liver cancer | Epithelial mesenchymal transition pathway | "miR 612 suppresses the invasive metastatic cascade ......" | 23478189 | |
| hsa-miR-612 | liver cancer | Epithelial mesenchymal transition pathway | "MiR 612 suppresses the stemness of liver cancer vi ......" | 24704424 | Colony formation |
Reported cancer prognosis affected by hsa-miR-612
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-612 | colorectal cancer | metastasis | "miR 612 negatively regulates colorectal cancer gro ......" | 26158514 | Transwell assay |
| hsa-miR-612 | liver cancer | metastasis; staging; tumor size | "miR 612 suppresses the invasive metastatic cascade ......" | 23478189 | |
| hsa-miR-612 | liver cancer | metastasis; drug resistance; tumorigenesis | "MiR 612 suppresses the stemness of liver cancer vi ......" | 24704424 | Colony formation |
| hsa-miR-612 | liver cancer | metastasis | "miR 612 suppresses stem cell like property of hepa ......" | 27685621 |
Reported gene related to hsa-miR-612
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-612 | colorectal cancer | AKT2 | "miR 612 negatively regulates colorectal cancer gro ......" | 26158514 |
| hsa-miR-612 | liver cancer | AKT2 | "AKT2 was confirmed to be a direct target of miR-61 ......" | 24704424 |
| hsa-miR-612 | liver cancer | AKT2 | "AKT2 was verified to be one of the direct targets ......" | 23478189 |