microRNA information: hsa-miR-615-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-615-3p | miRbase |
| Accession: | MIMAT0003283 | miRbase |
| Precursor name: | hsa-mir-615 | miRbase |
| Precursor accession: | MI0003628 | miRbase |
| Symbol: | MIR615 | HGNC |
| RefSeq ID: | NR_030753 | GenBank |
| Sequence: | UCCGAGCCUGGGUCUCCCUCUU |
Reported expression in cancers: hsa-miR-615-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-615-3p | breast cancer | downregulation | "Previous studies have shown that miR-615 regulates ......" | 26064277 | |
| hsa-miR-615-3p | colorectal cancer | upregulation | "Deep Sequencing the MicroRNA Transcriptome in Colo ......" | 23824282 | RNA-Seq |
Reported cancer pathway affected by hsa-miR-615-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-615-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "MiR 615 inhibited cell proliferation and cell cycl ......" | 26064277 | |
| hsa-miR-615-3p | colon cancer | Apoptosis pathway | "In this study colon cancer HT-29 cells were stably ......" | 20859756 |
Reported cancer prognosis affected by hsa-miR-615-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-615-3p | breast cancer | tumorigenesis | "MiR 615 inhibited cell proliferation and cell cycl ......" | 26064277 | |
| hsa-miR-615-3p | liver cancer | metastasis | "PU.1 Is Identified as a Novel Metastasis Suppresso ......" | 25987019 | |
| hsa-miR-615-3p | lymphoma | poor survival | "Fourteen miRs were differentially expressed betwee ......" | 23835716 |
Reported gene related to hsa-miR-615-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-615-3p | breast cancer | AKT2 | "MiR 615 inhibited cell proliferation and cell cycl ......" | 26064277 |
| hsa-miR-615-3p | pancreatic cancer | CDX2 | "CDX2 inhibits pancreatic adenocarcinoma cell proli ......" | 26269116 |
| hsa-miR-615-3p | colon cancer | MAPK8 | "Furthermore bioinformatic analyses of these 12 miR ......" | 20859756 |
| hsa-miR-615-3p | lymphoma | RTEL1 | "Fourteen miRs were differentially expressed betwee ......" | 23835716 |
| hsa-miR-615-3p | liver cancer | SHMT2 | "miR 615 5p prevents proliferation and migration th ......" | 26662310 |
| hsa-miR-615-3p | liver cancer | SPI1 | "PU.1 Is Identified as a Novel Metastasis Suppresso ......" | 25987019 |
Expression profile in cancer corhorts:
