microRNA information: hsa-miR-616-3p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-616-3p | miRbase |
Accession: | MIMAT0004805 | miRbase |
Precursor name: | hsa-mir-616 | miRbase |
Precursor accession: | MI0003629 | miRbase |
Symbol: | MIR616 | HGNC |
RefSeq ID: | NR_030346 | GenBank |
Sequence: | AGUCAUUGGAGGGUUUGAGCAG |
Reported expression in cancers: hsa-miR-616-3p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|
Reported cancer pathway affected by hsa-miR-616-3p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-616-3p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-616-3p | prostate cancer | malignant trasformation; drug resistance | "MicroRNA 616 induces androgen independent growth o ......" | 21224345 |
Reported gene related to hsa-miR-616-3p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-616-3p | prostate cancer | TFPI2 | "Microarray profiling and bioinformatics analysis i ......" | 21224345 |
Expression profile in cancer corhorts: