microRNA information: hsa-miR-622
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-622 | miRbase |
Accession: | MIMAT0003291 | miRbase |
Precursor name: | hsa-mir-622 | miRbase |
Precursor accession: | MI0003636 | miRbase |
Symbol: | MIR622 | HGNC |
RefSeq ID: | NR_030754 | GenBank |
Sequence: | ACAGUCUGCUGAGGUUGGAGC |
Reported expression in cancers: hsa-miR-622
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-622 | colorectal cancer | upregulation | "Importantly miR-622 was highly expressed in tumors ......" | 25961730 | |
hsa-miR-622 | colorectal cancer | downregulation | "Here we studied the role of miR-622 in CRC and cla ......" | 26333174 | |
hsa-miR-622 | gastric cancer | downregulation | "To evaluate the biological and clinical characteri ......" | 21528065 | qPCR |
hsa-miR-622 | liver cancer | downregulation | "microRNA 622 acts as a tumor suppressor in hepatoc ......" | 26467022 | |
hsa-miR-622 | ovarian cancer | upregulation | "Physiologically miR-622 inversely correlates with ......" | 26774475 |
Reported cancer pathway affected by hsa-miR-622
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-622 | liver cancer | Apoptosis pathway | "microRNA 622 acts as a tumor suppressor in hepatoc ......" | 26467022 | Colony formation; Luciferase |
hsa-miR-622 | ovarian cancer | cell cycle pathway | "Platinum and PARP Inhibitor Resistance Due to Over ......" | 26774475 |
Reported cancer prognosis affected by hsa-miR-622
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-622 | colorectal cancer | drug resistance | "Radiation induced microRNA 622 causes radioresista ......" | 25961730 | |
hsa-miR-622 | colorectal cancer | metastasis | "MiR 622 inhibited colorectal cancer occurrence and ......" | 26333174 | Luciferase |
hsa-miR-622 | gastric cancer | metastasis; tumorigenesis; differentiation | "Down regulation of miR 622 in gastric cancer promo ......" | 21528065 | Luciferase |
hsa-miR-622 | liver cancer | worse prognosis | "EZH2 mediated loss of miR 622 determines CXCR4 act ......" | 26404566 | |
hsa-miR-622 | liver cancer | worse prognosis | "microRNA 622 acts as a tumor suppressor in hepatoc ......" | 26467022 | Colony formation; Luciferase |
hsa-miR-622 | lung cancer | metastasis; cell migration | "Foxo3a mediated overexpression of microRNA 622 sup ......" | 26528854 | |
hsa-miR-622 | ovarian cancer | worse prognosis | "Quantitative reverse transcription-polymerase chai ......" | 24591819 | |
hsa-miR-622 | ovarian cancer | drug resistance | "Platinum and PARP Inhibitor Resistance Due to Over ......" | 26774475 |
Reported gene related to hsa-miR-622
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-622 | colorectal cancer | HRAS | "MiR 622 inhibited colorectal cancer occurrence and ......" | 26333174 |
hsa-miR-622 | sarcoma | HRAS | "We demonstrated that miR-622 expression was lower ......" | 26596833 |
hsa-miR-622 | lung cancer | ARID1A | "The expression levels of several miRNAs and their ......" | 27524914 |
hsa-miR-622 | ovarian cancer | BRCA1 | "Platinum and PARP Inhibitor Resistance Due to Over ......" | 26774475 |
hsa-miR-622 | liver cancer | CXCR4 | "EZH2 mediated loss of miR 622 determines CXCR4 act ......" | 26404566 |
hsa-miR-622 | lung cancer | EGF | "Mechanistic analyses showed that overexpression of ......" | 26528854 |
hsa-miR-622 | liver cancer | EZH2 | "EZH2 mediated loss of miR 622 determines CXCR4 act ......" | 26404566 |
hsa-miR-622 | lung cancer | FOXO3 | "Foxo3a mediated overexpression of microRNA 622 sup ......" | 26528854 |
hsa-miR-622 | gastric cancer | ING1 | "Down regulation of miR 622 in gastric cancer promo ......" | 21528065 |
hsa-miR-622 | liver cancer | MAP2K6 | "Bioinformatic analysis and luciferase reporter ass ......" | 26467022 |
hsa-miR-622 | liver cancer | MAP4K4 | "Bioinformatic analysis and luciferase reporter ass ......" | 26467022 |
hsa-miR-622 | liver cancer | MAPK8 | "Inhibition of JNK and NF-κB signaling phenocopied ......" | 26467022 |
hsa-miR-622 | lung cancer | SNAI1 | "Here we identified the 3'-untranslated region of H ......" | 26528854 |
hsa-miR-622 | lung cancer | VIM | "Here we identified the 3'-untranslated region of H ......" | 26528854 |